Mir27b (microRNA 27b) - Rat Genome Database

Name: Mir27b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

	Submit Data \| Help \| Video Tutorials \| News \| Publications \| Download \| REST API \| Citing RGD \| Contact
	Search RGD Grant Resources Citing RGD About Us Contact Us Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) (beta) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer) Overgo Probe Designer Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease COVID-19 Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease Find Models new Genetic Models Autism Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive Pathways Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
	Advanced Search (OLGA)

Gene: Mir27b (microRNA 27b) Rattus norvegicus

Analyze

Symbol:

Mir27b

Name:

microRNA 27b

RGD ID:

2325593

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Predicted to be involved in several processes, including negative regulation of cholesterol transport; positive regulation of cell population proliferation; and regulation of gene expression. Predicted to act upstream of or within several processes, including cellular response to forskolin; regulation of protein metabolic process; and regulation of signal transduction. Predicted to be located in extracellular exosome. Human ortholog(s) of this gene implicated in stomach cancer. Orthologous to human MIR27B (microRNA 27b); INTERACTS WITH 1,3,5-trinitro-1,3,5-triazinane; 2,5-hexanedione; aflatoxin B1.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-27b; rno-mir-27b

RGD Orthologs

Human

Mouse

Dog

Pig

Alliance Genes

More Info

more info ...

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	17	1,813,427 - 1,813,523 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	17	1,813,426 - 1,813,529 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	17	1,832,126 - 1,832,222 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	17	3,374,724 - 3,374,820 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	17	1,829,576 - 1,829,672 (-)	NCBI	Rnor_WKY
Rnor_6.0	17	823,461 - 823,557 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	17	823,461 - 823,557 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	17	816,274 - 816,370 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	17	709,223 - 709,319 (+)	NCBI		Celera
Cytogenetic Map	17	p14	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Chemical and Drug Induced Liver Injury (ISO)

cholestasis (ISO)

colorectal cancer (ISO)

intellectual disability (ISO)

Myocardial Reperfusion Injury (ISO)

pancreatitis (ISO)

stomach cancer (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (EXP,ISO)

17beta-estradiol (ISO)

2,5-hexanedione (EXP)

aflatoxin B1 (EXP)

arsenite(3-) (ISO)

arsenous acid (ISO)

benzo[a]pyrene (ISO)

bis(2-chloroethyl) sulfide (ISO)

bisphenol A (ISO)

bleomycin A2 (EXP)

bucladesine (ISO)

butanal (ISO)

cadmium atom (EXP)

cadmium dichloride (EXP,ISO)

carbon nanotube (ISO)

chromium(6+) (ISO)

cisplatin (EXP,ISO)

curcumin (ISO)

DDT (ISO)

diarsenic trioxide (ISO)

ferulic acid (EXP)

formaldehyde (ISO)

fumonisin B1 (ISO)

hydrogen peroxide (ISO)

isoprene (ISO)

lead diacetate (ISO)

Licochalcone B (ISO)

mechlorethamine (EXP)

medroxyprogesterone acetate (ISO)

methapyrilene (EXP)

mono(2-ethylhexyl) phthalate (ISO)

myo-inositol hexakisphosphate (EXP)

paracetamol (EXP,ISO)

PhIP (ISO)

progesterone (ISO)

propofol (EXP)

quercetin (EXP)

resveratrol (EXP)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

thioacetamide (EXP)

titanium dioxide (ISO)

zinc atom (EXP)

zinc(0) (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to forskolin (ISO)

cellular response to inorganic substance (ISO)

cellular response to leukemia inhibitory factor (ISO)

cellular response to vascular endothelial growth factor stimulus (ISO)

cholesterol homeostasis (ISO)

miRNA-mediated gene silencing (ISO)

miRNA-mediated gene silencing by inhibition of translation (ISO)

myelination (ISO)

negative regulation of cell adhesion molecule production (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of CoA-transferase activity (ISO)

negative regulation of fat cell differentiation (ISO)

negative regulation of gene expression (ISO)

negative regulation of I-kappaB phosphorylation (ISO)

negative regulation of interleukin-1 beta production (ISO)

negative regulation of lipid binding (ISO)

negative regulation of low-density lipoprotein particle clearance (ISO)

negative regulation of low-density lipoprotein particle receptor binding (ISO)

negative regulation of monooxygenase activity (ISO)

negative regulation of NIK/NF-kappaB signaling (ISO)

negative regulation of receptor-mediated endocytosis involved in cholesterol transport (ISO)

negative regulation of tumor necrosis factor-mediated signaling pathway (ISO)

obsolete regulation of cholesterol esterification (ISO)

positive regulation of angiogenesis (ISO)

positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis (ISO)

positive regulation of cell adhesion involved in sprouting angiogenesis (ISO)

positive regulation of cell migration involved in sprouting angiogenesis (ISO)

positive regulation of cell proliferation in bone marrow (ISO)

positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (ISO)

positive regulation of ERK1 and ERK2 cascade (ISO)

positive regulation of gene expression (ISO)

positive regulation of intrinsic apoptotic signaling pathway (ISO)

positive regulation of tumor necrosis factor production (ISO)

regulation of gene expression (ISO)

regulation of semaphorin-plexin signaling pathway (ISO)

regulation of superoxide metabolic process (ISO)

response to bacterium (ISO)

retina vasculature development in camera-type eye (ISO)

sensory perception of sound (ISO)

Wnt signaling pathway (ISO)

Cellular Component

extracellular exosome (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

RNA binding (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
2.	The miR27b-CCNG1-P53-miR-508-5p axis regulates multidrug resistance of gastric cancer.	Shang Y, etal., Oncotarget. 2016 Jan 5;7(1):538-49. doi: 10.18632/oncotarget.6374.

Additional References at PubMed

PMID:16381832	PMID:16682203	PMID:16766679	PMID:17604727	PMID:17805466	PMID:20403161	PMID:20439489	PMID:20805985	PMID:21536891	PMID:21993888	PMID:23613728	PMID:23646144
PMID:24205035	PMID:24815159	PMID:25795136	PMID:27716060	PMID:27863390	PMID:28484848	PMID:28943435	PMID:29187585	PMID:29777440	PMID:30549040	PMID:31881012	PMID:32170506
PMID:35282795	PMID:35599576	PMID:35818274

Genomics

Comparative Map Data

Mir27b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
mRatBN7.2	17	1,813,427 - 1,813,523 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	17	1,813,426 - 1,813,529 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	17	1,832,126 - 1,832,222 (-)	NCBI	Rnor_SHR
UTH_Rnor_SHRSP_BbbUtx_1.0	17	3,374,724 - 3,374,820 (-)	NCBI	Rnor_SHRSP
UTH_Rnor_WKY_Bbb_1.0	17	1,829,576 - 1,829,672 (-)	NCBI	Rnor_WKY
Rnor_6.0	17	823,461 - 823,557 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	17	823,461 - 823,557 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	17	816,274 - 816,370 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	17	709,223 - 709,319 (+)	NCBI		Celera
Cytogenetic Map	17	p14	NCBI

MIR27B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	95,085,445 - 95,085,541 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p13 Ensembl	9	95,085,445 - 95,085,541 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	9	97,847,727 - 97,847,823 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	9	96,887,547 - 96,887,643 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	9	68,288,758 - 68,288,854 (+)	NCBI		Celera
Cytogenetic Map	9	q22.32	NCBI
HuRef	9	67,457,280 - 67,457,376 (+)	NCBI		HuRef
CHM1_1	9	97,994,205 - 97,994,301 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	9	107,254,838 - 107,254,934 (+)	NCBI		T2T-CHM13v2.0

Mir27b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	13	63,448,526 - 63,448,598 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	13	63,448,526 - 63,448,598 (+)	Ensembl		GRCm39 Ensembl
GRCm38	13	63,300,712 - 63,300,784 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	13	63,300,712 - 63,300,784 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	13	63,402,020 - 63,402,092 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	13	64,954,893 - 64,954,965 (+)	NCBI		Celera
Cytogenetic Map	13	B3	NCBI

MIR27B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	71,678,117 - 71,678,179 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	71,678,105 - 71,678,191 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	72,440,078 - 72,440,140 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	71,982,476 - 71,982,538 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	1	71,982,464 - 71,982,550 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	1	71,793,881 - 71,793,943 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	71,557,950 - 71,558,012 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	72,264,234 - 72,264,296 (-)	NCBI		UU_Cfam_GSD_1.0

MIR27B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	10	27,079,954 - 27,080,056 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	10	27,079,963 - 27,080,042 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	10	31,340,880 - 31,340,959 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Rxra	rno-miR-27b-3p	Mirtarbase	external_info	Luciferase reporter assay//qRT-PCR//Western blot	Functional MTI	19185571

Predicted Targets

	Summary Value
Count of predictions:	10978
Count of gene targets:	6544
Count of transcripts:	7021
Interacting mature miRNAs:	rno-miR-27b-3p, rno-miR-27b-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Microtar, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9590316	Scort21	Serum corticosterone level QTL 21	4.75	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	17	1	22871563	Rat
1354581	Bp247	Blood pressure QTL 247	4.5		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	17	1	69599340	Rat
1354658	Spl8	Serum phospholipid level QTL 8	3.8		blood VLDL phospholipid amount (VT:0010507)	blood very low density lipoprotein phospholipid level (CMO:0001571)	17	1	60781592	Rat
1354662	Rf49	Renal function QTL 49	2.9		blood creatinine amount (VT:0005328)	plasma creatinine level (CMO:0000537)	17	1	69599340	Rat
70184	BpQTLcluster14	Blood pressure QTL cluster 14	3.38		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	17	1	31990913	Rat
631207	Niddm41	Non-insulin dependent diabetes mellitus QTL 41			blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	17	1	37830672	Rat
10401807	Kidm52	Kidney mass QTL 52			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	17	1	31701463	Rat

Markers in Region

BE113529

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	17	1,813,609 - 1,813,797 (-)	MAPPER	mRatBN7.2
Rnor_6.0	17	823,188 - 823,375	NCBI	Rnor6.0
Rnor_5.0	17	816,001 - 816,188	UniSTS	Rnor5.0
RGSC_v3.4	17	7,351,631 - 7,351,818	UniSTS	RGSC3.4
Celera	17	708,950 - 709,137	UniSTS
RH 3.4 Map	17	10.5	UniSTS

Expression

RNA-SEQ Expression

High: > 1000 TPM value Medium: Between 11 and 1000 TPM
Low: Between 0.5 and 10 TPM Below Cutoff: < 0.5 TPM

	alimentary part of gastrointestinal system	circulatory system	endocrine system	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system	appendage
High
Medium		8	21	7	10	7	8	8	20	12	11	8	8
Low	2	25	13	11	8	11		3	44	20	25	3
Below cutoff		2	5	5	1	5			4	1	1

View RNA-SEQ Expression Data

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031832	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACYVU010000284	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

ENSRNOT00000053699

RefSeq Status:

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	17	1,813,426 - 1,813,529 (-)	Ensembl
Rnor_6.0 Ensembl	17	823,461 - 823,557 (+)	Ensembl

RefSeq Acc Id:

NR_031832

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2	17	1,813,427 - 1,813,523 (-)	NCBI
Rnor_6.0	17	823,461 - 823,557 (+)	NCBI
Rnor_5.0	17	816,274 - 816,370 (+)	NCBI
Celera	17	709,223 - 709,319 (+)	NCBI

Sequence:

show sequence

ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGGTTTCCGCTTTGTTCA
CAGTGGCTAAGTTCTGCACCTGAAGAGAAGGTG

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325593	AgrOrtholog
BioCyc Gene	G2FUF-10518	BioCyc
Ensembl Genes	ENSRNOG00000035576	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053699	ENTREZGENE
miRBase	MI0000859	ENTREZGENE
NCBI Gene	100314005	ENTREZGENE
PhenoGen	Mir27b	PhenoGen
RNAcentral	URS000059311D	RNACentral
	URS000075B0A5	RNACentral
	URS000075D23F	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir27b	microRNA 27b	Mir27b	microRNA mir-27b	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir27b	microRNA mir-27b			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD