Symbol:
Mir488
Name:
microRNA 488
RGD ID:
2325487
Description:
Predicted to enable mRNA base-pairing translational repressor activity. Predicted to be involved in negative regulation of gene expression and negative regulation of inflammatory response. Orthologous to human MIR488 (microRNA 488); INTERACTS WITH 2,5-hexanedione; endosulfan; furan.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
rno-mir-488
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 73,216,541 - 73,216,619 (+) NCBI GRCr8 mRatBN7.2 13 70,683,064 - 70,683,142 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 70,683,064 - 70,683,142 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 73,260,030 - 73,260,108 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 74,560,257 - 74,560,335 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 71,819,607 - 71,819,685 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 76,198,593 - 76,198,671 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 76,198,593 - 76,198,671 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 81,112,954 - 81,113,032 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 13 70,496,620 - 70,496,698 (+) NCBI Celera Cytogenetic Map 13 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir488 (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 73,216,541 - 73,216,619 (+) NCBI GRCr8 mRatBN7.2 13 70,683,064 - 70,683,142 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 70,683,064 - 70,683,142 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 73,260,030 - 73,260,108 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 74,560,257 - 74,560,335 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 71,819,607 - 71,819,685 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 13 76,198,593 - 76,198,671 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 13 76,198,593 - 76,198,671 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 13 81,112,954 - 81,113,032 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 13 70,496,620 - 70,496,698 (+) NCBI Celera Cytogenetic Map 13 q22 NCBI
MIR488 (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 177,029,363 - 177,029,445 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 177,029,363 - 177,029,445 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 176,998,499 - 176,998,581 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 175,265,121 - 175,265,203 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 1 150,108,504 - 150,108,586 (-) NCBI Celera Cytogenetic Map 1 q25.2 NCBI HuRef 1 148,224,993 - 148,225,075 (-) NCBI HuRef CHM1_1 1 178,422,539 - 178,422,621 (-) NCBI CHM1_1 T2T-CHM13v2.0 1 176,384,002 - 176,384,084 (-) NCBI T2T-CHM13v2.0
Mir488 (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 158,333,195 - 158,333,303 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 158,333,195 - 158,333,303 (+) Ensembl GRCm39 Ensembl GRCm38 1 158,505,625 - 158,505,733 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 158,505,625 - 158,505,733 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 160,435,756 - 160,435,864 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 1 160,900,459 - 160,900,567 (+) NCBI Celera Cytogenetic Map 1 H1 NCBI cM Map 1 68.46 NCBI
MIR488 (Canis lupus familiaris - dog)
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 22,597,953 - 22,598,035 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 22,597,953 - 22,598,035 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 22,122,143 - 22,122,225 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 22,344,624 - 22,344,706 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 22,344,624 - 22,344,706 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 22,250,245 - 22,250,327 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 22,350,320 - 22,350,402 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 22,493,251 - 22,493,333 (+) NCBI UU_Cfam_GSD_1.0
.
Predicted Targets
Count of predictions: 10276 Count of gene targets: 5999 Count of transcripts: 6399 Interacting mature miRNAs: rno-miR-488-3p, rno-miR-488-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
1298066 Bp159 Blood pressure QTL 159 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 46088046 91088046 Rat 10755495 Bp387 Blood pressure QTL 387 3.78 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34663461 87525369 Rat 1354655 Bp241 Blood pressure QTL 241 3.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 56056920 101056920 Rat 8655951 Rf63 Renal function QTL 63 12.2 blood urea nitrogen amount (VT:0005265) plasma urea nitrogen level (CMO:0000586) 13 69060519 77046890 Rat 70220 Bp55 Blood pressure QTL 55 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 8655945 Rf61 Renal function QTL 61 3.6 blood creatinine amount (VT:0005328) creatinine clearance (CMO:0000765) 13 69060519 86800898 Rat 71119 Thym2 Thymus enlargement QTL 2 3.8 thymus mass (VT:0004954) thymus weight to body weight ratio (CMO:0000612) 13 46197976 84753113 Rat 4889861 Pur29 Proteinuria QTL 29 13.8 0.005 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 13 37415584 80753406 Rat 1331783 Bp221 Blood pressure QTL 221 3.72886 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 69060519 86800898 Rat 12879441 Bp396 Blood pressure QTL 396 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 45699983 90699983 Rat 2293687 Bss26 Bone structure and strength QTL 26 4.6 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 13 65103704 106807694 Rat 1300166 Kidm6 Kidney mass QTL 6 3.93 kidney mass (VT:0002707) single kidney wet weight to body weight ratio (CMO:0000622) 13 69060519 86800898 Rat 619615 Bp80 Blood pressure QTL 80 0.0354 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 39754544 84754544 Rat 2303028 Bp329 Blood pressure QTL 329 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 58497872 73485113 Rat 1581570 Eae17 Experimental allergic encephalomyelitis QTL 17 4.1 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 8897350 101631289 Rat 61340 Bp25 Blood pressure QTL 25 4.2 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 34535218 79535218 Rat 1581573 Uae36 Urinary albumin excretion QTL 36 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 1549897 Stresp12 Stress response QTL 12 3.35 stress-related behavior trait (VT:0010451) number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960) 13 38433408 83433408 Rat 724564 Uae11 Urinary albumin excretion QTL 11 5.7 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 13 59492522 77046890 Rat 7207885 Glom27 Glomerulus QTL 27 3.9 kidney glomerulus integrity trait (VT:0010546) kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139) 13 20605871 101339738 Rat 7387280 Uae43 Urinary albumin excretion QTL 43 5.69 0.4174 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 66451204 106807694 Rat 738026 Lnnr5 Liver neoplastic nodule remodeling QTL 5 3.29 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number (CMO:0001461) 13 59874408 85581182 Rat 70181 BpQTLcluster11 Blood pressure QTL cluster 11 6.922 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 13 31241331 93395974 Rat 2293702 Bss34 Bone structure and strength QTL 34 4.61 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 13 65103704 106807694 Rat 61349 Bp31 Blood pressure QTL 31 5.75 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 13 37374509 82374509 Rat 2303563 Bw89 Body weight QTL 89 6 body mass (VT:0001259) body weight (CMO:0000012) 13 32284471 77284471 Rat 1354621 Rf47 Renal function QTL 47 3.7 kidney renin amount (VT:0010559) kidney renin level (CMO:0002166) 13 30395351 101056920 Rat 1581554 Pur11 Proteinuria QTL 11 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 12879477 Bp401 Blood pressure QTL 401 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 37262092 82262092 Rat 1331750 Bp220 Blood pressure QTL 220 2.98 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 13 37415584 82415584 Rat 1641901 Alcrsp6 Alcohol response QTL 6 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 13 52362171 97362171 Rat 12879475 Bp400 Blood pressure QTL 400 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 61825626 106807694 Rat 1354666 Bp244 Blood pressure QTL 244 4.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 1 101056920 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000054388
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 70,683,064 - 70,683,142 (+) Ensembl Rnor_6.0 Ensembl 13 76,198,593 - 76,198,671 (+) Ensembl
RefSeq Acc Id:
NR_032299
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 73,216,541 - 73,216,619 (+) NCBI mRatBN7.2 13 70,683,064 - 70,683,142 (+) NCBI Rnor_6.0 13 76,198,593 - 76,198,671 (+) NCBI Rnor_5.0 13 81,112,954 - 81,113,032 (+) NCBI Celera 13 70,496,620 - 70,496,698 (+) NCBI
Sequence:
AATCCTCTCTCCCAGATAATGGCACTCTCAAACAAGTTTCTACATTGTTTGAAAGGCTGTTTCTTGGTCAGAAGACTCT
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2015-04-09
Mir488
microRNA 488
Mir488
microRNA mir-488
Name updated
61478
APPROVED
2010-06-02
Mir488
microRNA mir-488
Symbol and Name status set to provisional
70820
PROVISIONAL