Symbol:
Mir296
Name:
microRNA 296
RGD ID:
2325345
Description:
Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing translational repressor activity. Involved in negative regulation of thyroid gland epithelial cell proliferation. Orthologous to human MIR296 (microRNA 296); INTERACTS WITH atrazine; bis(2-ethylhexyl) phthalate; bisphenol A.
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
microRNA mir-296; rno-mir-296
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 183,470,069 - 183,470,146 (-) NCBI GRCr8 mRatBN7.2 3 163,051,838 - 163,051,915 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 163,051,838 - 163,051,915 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 166,850,873 - 166,850,950 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 175,348,455 - 175,348,532 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 173,091,717 - 173,091,794 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 172,357,490 - 172,357,567 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 172,357,490 - 172,357,567 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 178,408,788 - 178,408,865 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 3 162,226,950 - 162,227,027 (-) NCBI Celera Cytogenetic Map 3 q43 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Mir296 (Rattus norvegicus - Norway rat)
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 183,470,069 - 183,470,146 (-) NCBI GRCr8 mRatBN7.2 3 163,051,838 - 163,051,915 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 163,051,838 - 163,051,915 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 166,850,873 - 166,850,950 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 175,348,455 - 175,348,532 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 173,091,717 - 173,091,794 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 172,357,490 - 172,357,567 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 172,357,490 - 172,357,567 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 178,408,788 - 178,408,865 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 3 162,226,950 - 162,227,027 (-) NCBI Celera Cytogenetic Map 3 q43 NCBI
MIR296 (Homo sapiens - human)
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 20 58,817,615 - 58,817,694 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 20 58,817,615 - 58,817,694 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 20 57,392,670 - 57,392,749 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Celera 20 54,133,130 - 54,133,209 (-) NCBI Celera Cytogenetic Map 20 q13.32 NCBI HuRef 20 54,179,091 - 54,179,170 (-) NCBI HuRef CHM1_1 20 57,294,310 - 57,294,389 (-) NCBI CHM1_1 T2T-CHM13v2.0 20 60,600,214 - 60,600,293 (-) NCBI T2T-CHM13v2.0
Mir296 (Mus musculus - house mouse)
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 174,108,840 - 174,108,918 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 174,108,840 - 174,108,918 (-) Ensembl GRCm39 Ensembl GRCm38 2 174,267,047 - 174,267,125 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 174,267,047 - 174,267,125 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 174,092,548 - 174,092,626 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 2 180,232,045 - 180,232,123 (-) NCBI Celera Cytogenetic Map 2 H4 NCBI cM Map 2 97.88 NCBI
.
Predicted Targets
Count of predictions: 30260 Count of gene targets: 12610 Count of transcripts: 13877 Interacting mature miRNAs: rno-miR-296-3p, rno-miR-296-5p Prediction methods: Microtar, Miranda, Pita, Rnahybrid, Targetscan Result types: miRGate_prediction
12879876 Bw182 Body weight QTL 182 0.003 body mass (VT:0001259) body weight (CMO:0000012) 3 145925360 166177555 Rat 2301411 Bp320 Blood pressure QTL 320 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 3 145925360 166177555 Rat 2312673 Scl63 Serum cholesterol level QTL 63 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 3 98535255 168026850 Rat 12879872 Cm97 Cardiac mass QTL 97 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 3 145925360 166177555 Rat 1598877 Bp285 Blood pressure QTL 285 1.5 0.03 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 120538241 165538241 Rat 1578653 Vnigr3 Vascular neointimal growth QTL 3 3.1 artery morphology trait (VT:0002191) artery neointimal hyperplastic lesion area (CMO:0001414) 3 130656562 169034231 Rat 12879873 Cm96 Cardiac mass QTL 96 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 3 145925360 166177555 Rat 12879874 Cm98 Cardiac mass QTL 98 0.005 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 3 145925360 166177555 Rat 1298068 Bp167 Blood pressure QTL 167 0.004 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 141074471 169034231 Rat 12879875 Kidm64 Kidney mass QTL 64 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 3 145925360 166177555 Rat 70216 Cm14 Cardiac mass QTL 14 2.1 heart mass (VT:0007028) heart wet weight (CMO:0000069) 3 31172320 163586636 Rat 2298477 Eau4 Experimental allergic uveoretinitis QTL 4 0.0011 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 3 137398739 169034231 Rat 1300161 Rf10 Renal function QTL 10 3.57 renal blood flow trait (VT:2000006) absolute change in renal vascular resistance (CMO:0001900) 3 161192952 169034231 Rat 8552791 Vie2 Viral induced encephalitis QTL 2 4.1 brain integrity trait (VT:0010579) encephalitis incidence/prevalence measurement (CMO:0002361) 3 145956084 169034231 Rat 2317883 Alcrsp26 Alcohol response QTL 26 1.8 0.63 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 3 145526770 169034231 Rat 9589106 Insul23 Insulin level QTL 23 13.86 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 3 131635904 169034231 Rat 10755461 Coatc16 Coat color QTL 16 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 3 122438700 167438700 Rat 1559282 Emca5 Estrogen-induced mammary cancer QTL 5 3.9 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 3 43827364 169034231 Rat 2303620 Vencon4 Ventilatory control QTL 4 3.9 respiration trait (VT:0001943) tidal volume (CMO:0000222) 3 127162703 168026850 Rat 1576306 Schws3 Schwannoma susceptibility QTL 3 0.001 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 3 118839124 163839124 Rat 2312659 Slep7 Serum leptin concentration QTL 7 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 3 98535255 168026850 Rat 1578666 Vnigr1 Vascular neointimal growth QTL 1 4.6 artery morphology trait (VT:0002191) artery lumen area (CMO:0001409) 3 149040888 168026850 Rat 1578656 Vnigr2 Vascular neointimal growth QTL 2 4.2 artery morphology trait (VT:0002191) lesioned artery residual lumen area (CMO:0001417) 3 130656562 169034231 Rat 8552952 Pigfal13 Plasma insulin-like growth factor 1 level QTL 13 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 3 138799500 169034231 Rat 12879871 Am7 Aortic mass QTL 7 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 3 145925360 166177555 Rat 631541 Bp81 Blood pressure QTL 81 4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 124122556 169034231 Rat 2312670 Bw94 Body weight QTL 94 0.01 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 3 98535255 168026850 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSRNOT00000053742
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 3 163,051,838 - 163,051,915 (-) Ensembl Rnor_6.0 Ensembl 3 172,357,490 - 172,357,567 (-) Ensembl
RefSeq Acc Id:
NR_031940
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 183,470,069 - 183,470,146 (-) NCBI mRatBN7.2 3 163,051,838 - 163,051,915 (-) NCBI Rnor_6.0 3 172,357,490 - 172,357,567 (-) NCBI Rnor_5.0 3 178,408,788 - 178,408,865 (-) NCBI Celera 3 162,226,950 - 162,227,027 (-) NCBI
Sequence:
GGACCTTTCTGGAGGGCCCCCCCTCAATCCTGTTGTGCTCGCTTCAGAGGGTTGGGTGGAGGCTCTCCTGAAGGTGTC
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2013-08-14
Mir296
microRNA 296
Mir296
microRNA mir-296
Nomenclature updated to reflect human and mouse nomenclature
1299863
APPROVED