Advanced Search (OLGA)

Gene: RPL23A (ribosomal protein L23a) Chlorocebus sabaeus

Subscribe to Updates

Analyze

Symbol:

RPL23A

Name:

ribosomal protein L23a

RGD ID:

18791032

Description:

ENCODES a protein that exhibits large ribosomal subunit rRNA binding (ortholog); INVOLVED IN translation (inferred); PARTICIPATES IN ribosome biogenesis pathway; translation pathway; ASSOCIATED WITH Breast Neoplasms (ortholog); Parkinson's disease (ortholog); FOUND IN cytosolic large ribosomal subunit (ortholog); cytosolic ribosome (ortholog); nucleus (ortholog)

Type:

protein-coding

RefSeq Status:

MODEL

Previously known as:

60S ribosomal protein L23a

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

ChlSab1.1 - Green Monkey 1.1 Assembly

Position:

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	16	22,488,144 - 22,491,864 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
Vero_WHO_p1.0	NW_023666075	7,631,113 - 7,635,309 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RPL23A	Green Monkey	Breast Neoplasms		ISO	RPL23A (Homo sapiens)	9068941	CTD Direct Evidence: marker/mechanism	CTD	PMID:21466612
RPL23A	Green Monkey	Parkinson's disease		ISO	RPL23A (Homo sapiens)	9068941	CTD Direct Evidence: marker/mechanism	CTD	PMID:18353766

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RPL23A	Green Monkey	translation	involved_in	IEA	InterPro:IPR012678 more ...	150520179		InterPro	GO_REF:0000002

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RPL23A	Green Monkey	cytoplasm	located_in	IEA	UniProtKB:P62751 and ensembl:ENSMUSP00000099541	150520179		Ensembl	GO_REF:0000107
RPL23A	Green Monkey	cytosolic large ribosomal subunit		ISO	Rpl23a (Rattus norvegicus)	9068941		RGD	PMID:1894596 and REF_RGD_ID:11036075
RPL23A	Green Monkey	cytosolic large ribosomal subunit	part_of	IEA	UniProtKB:P62751 and ensembl:ENSMUSP00000099541	150520179		Ensembl	GO_REF:0000107
RPL23A	Green Monkey	cytosolic ribosome	part_of	ISO	RPL23A (Homo sapiens)	9068941	PMID:23636399	FlyBase	PMID:23636399
RPL23A	Green Monkey	nucleus	located_in	ISO	RPL23A (Homo sapiens)	9068941	PMID:9687515	UniProt	PMID:9687515
RPL23A	Green Monkey	ribonucleoprotein complex	part_of	IEA	UniProtKB-KW:KW-0687	150520179		UniProt	GO_REF:0000043
RPL23A	Green Monkey	ribosomal subunit	part_of	IEA	ARBA:ARBA00027734	150520179		UniProt	GO_REF:0000117
RPL23A	Green Monkey	ribosome	located_in	IEA	UniProtKB-KW:KW-0689	150520179		UniProt	GO_REF:0000043
RPL23A	Green Monkey	ribosome	located_in	IEA	InterPro:IPR012678 more ...	150520179		InterPro	GO_REF:0000002
RPL23A	Green Monkey	synapse	is_active_in	IEA	UniProtKB:P62751 and ensembl:ENSMUSP00000099541	150520179		Ensembl	GO_REF:0000107

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RPL23A	Green Monkey	large ribosomal subunit rRNA binding		ISO	Rpl23a (Rattus norvegicus)	9068941		RGD	PMID:1894596 more ...
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:P55209	9068941	PMID:23414517	IntAct	PMID:23414517
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:P19712-PRO_0000038050	9068941	PMID:24965446	AgBase	PMID:24965446
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:O42480 more ...	9068941	PMID:9687515	UniProt	PMID:9687515
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:Q6QI06 and UniProtKB:Q8BKH7	9068941	PMID:21045808	UniProt	PMID:21045808
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:Q5S007	9068941	PMID:24725412	IntAct	PMID:24725412
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:P55209 and UniProtKB:Q13206	9068941	PMID:33961781	IntAct	PMID:33961781
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:Q13206	9068941	PMID:30021884	IntAct	PMID:30021884
RPL23A	Green Monkey	protein binding	enables	ISO	UniProtKB:Q15034	9068941	PMID:35637966	IntAct	PMID:35637966
RPL23A	Green Monkey	RNA binding	enables	IEA	UniProtKB-KW:KW-0694	150520179		UniProt	GO_REF:0000043
RPL23A	Green Monkey	rRNA binding	enables	IEA	UniProtKB-KW:KW-0699	150520179		UniProt	GO_REF:0000043
RPL23A	Green Monkey	rRNA binding	enables	IEA	InterPro:IPR001014	150520179		InterPro	GO_REF:0000002
RPL23A	Green Monkey	structural constituent of ribosome	enables	IEA	UniProtKB:P62751 and ensembl:ENSMUSP00000099541	150520179		Ensembl	GO_REF:0000107
RPL23A	Green Monkey	structural constituent of ribosome	enables	IEA	InterPro:IPR012678 more ...	150520179		InterPro	GO_REF:0000002
RPL23A	Green Monkey	TORC2 complex binding	enables	IEA	UniProtKB:P62751 and ensembl:ENSMUSP00000099541	150520179		Ensembl	GO_REF:0000107

RGD Manual Annotations

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
RPL23A	Green Monkey	ribosome biogenesis pathway		ISO	RPL23A (Homo sapiens)	9068941		RGD	PMID:23636399 and REF_RGD_ID:10002762
RPL23A	Green Monkey	translation pathway		ISO	RPL23A (Homo sapiens)	9068941		RGD	PMID:23636399 and REF_RGD_ID:10002762

PMID:22301074	PMID:30032202

RPL23A
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	16	22,488,144 - 22,491,864 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
Vero_WHO_p1.0	NW_023666075	7,631,113 - 7,635,309 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

RPL23A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	17	28,719,985 - 28,724,359 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	17	28,719,985 - 28,724,359 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	17	27,047,003 - 27,051,377 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	17	24,071,127 - 24,075,501 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	17	24,071,017 - 24,075,500	NCBI
Celera	17	23,906,165 - 23,910,537 (+)	NCBI		Celera
Cytogenetic Map	17	q11.2	NCBI
HuRef	17	23,255,900 - 23,260,272 (+)	NCBI		HuRef
CHM1_1	17	27,109,472 - 27,113,844 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	17	29,662,794 - 29,667,166 (+)	NCBI		T2T-CHM13v2.0

Rpl23a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	11	78,071,761 - 78,074,410 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	11	78,071,758 - 78,074,410 (-)	Ensembl		GRCm39 Ensembl
GRCm38	11	78,180,935 - 78,183,584 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	11	78,180,932 - 78,183,584 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	11	77,994,437 - 77,997,086 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	11	77,997,130 - 77,999,738 (-)	NCBI		MGSCv36	mm8
Celera	11	85,680,808 - 85,683,457 (-)	NCBI		Celera
Cytogenetic Map	11	B5	NCBI
cM Map	11	46.74	NCBI

Rpl23a
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	10	63,574,732 - 63,577,511 (-)	NCBI		GRCr8
mRatBN7.2	10	63,076,660 - 63,079,346 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	10	63,076,066 - 63,079,346 (-)	Ensembl		mRatBN7.2 Ensembl
mRatBN7.2 Ensembl	15	31,302,329 - 31,302,979 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	10	67,708,947 - 67,711,633 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	10	67,214,301 - 67,216,987 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	10	62,685,257 - 62,688,055 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	10	65,441,295 - 65,443,981 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	65,441,295 - 65,443,981 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	66,190,636 - 66,193,322 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	10	64,451,931 - 64,454,617 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	10	62,054,259 - 62,056,945 (-)	NCBI		Celera
Cytogenetic Map	10	q25	NCBI

Rpl23a
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955481	4,433,417 - 4,437,754 (-)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955481	4,433,367 - 4,437,838 (-)	NCBI	ChiLan1.0	ChiLan1.0

RPL23A
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	19	35,735,384 - 35,741,278 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	17	37,615,906 - 37,620,420 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	17	28,051,502 - 28,055,630 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	17	28,556,527 - 28,561,032 (-)	NCBI	panpan1.1	PanPan1.1	panPan2

LOC106558887
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	6	11,192,720 - 11,193,214 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
Dog10K_Boxer_Tasha	6	12,818,516 - 12,818,999 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	6	11,192,761 - 11,193,244 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	9	43,733,264 - 43,736,897 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	6	11,061,449 - 11,061,932 (+)	NCBI		UMICH_Zoey_3.1

Rpl23a
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024405602	42,051,881 - 42,055,814 (+)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936538	4,929,895 - 4,933,761 (+)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936538	4,929,893 - 4,933,759 (+)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

RPL23A
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	12	44,957,142 - 44,960,735 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	12	44,956,851 - 44,960,737 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	12	46,941,786 - 46,945,674 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Rpl23a
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla 1.0	NW_004624786	1,294,185 - 1,297,993 (+)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants in RPL23A
63 total Variants

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

hemolymphoid system	mesenchyme	mesoderm
7	7	7


RefSeq Transcripts	XM_008010827	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACDXN010000043	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XM_008010827 ⟹ XP_008009018

Type:

CODING

Position:

Green Monkey Assembly	Chr	Position (strand)	Source
ChlSab1.1	16	22,488,144 - 22,491,864 (+)	NCBI
Vero_WHO_p1.0	NW_023666075	7,631,113 - 7,635,309 (-)	NCBI

Sequence:

show sequence

TAAGTACAAAGCATCGCGAGTCTTTGATGAGATTTGGCGCTATAAGCCTGTGGGAACGGGCATCGGGGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCCG
AAGCCAAAGCGAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAAAAGAAGATCTGCACGTCACCTACCTTCCGGCGGCCCAAGACACTGCGACTCCGGAGGCAGCCC
AAATATCCTCGGAAGAGCGCCCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACTACGGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGA
TGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTCTATGACATTGATGTGGCCAAGGTCAACACCCTGATTCGGCCTGATGGAGAGAAAAAGGCGTATGTTCGACTGGCTCCTGATT
ACGACGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTAAATATATATATATATCTTTTCAACA

hide sequence


Protein RefSeqs	XP_008009018	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSCSAP00000003403.1
	ENSCSAP00000017732.1
	ENSCSAP00000017850.1
	ENSCSAP00000018652.1

RefSeq Acc Id:	XP_008009018 ⟸ XM_008010827
- UniProtKB:	A0A0D9SAG1 (UniProtKB/TrEMBL), A0A0D9SA43 (UniProtKB/TrEMBL)

Database	Acc Id	Source(s)
Ensembl Genes	ENSCSAG00000000142	UniProtKB/TrEMBL
	ENSCSAG00000000264	UniProtKB/TrEMBL
	ENSCSAG00000007131	ENTREZGENE, UniProtKB/TrEMBL
	ENSCSAG00000019142	UniProtKB/TrEMBL
Ensembl Transcript	ENSCSAT00000005172.1	UniProtKB/TrEMBL
	ENSCSAT00000018271.1	UniProtKB/TrEMBL
	ENSCSAT00000018393.1	UniProtKB/TrEMBL
	ENSCSAT00000019232.1	UniProtKB/TrEMBL
Gene3D-CATH	3.30.70.330	UniProtKB/TrEMBL
InterPro	Nucleotide-bd_a/b_plait_sf	UniProtKB/TrEMBL
	Ribosomal_L23	UniProtKB/TrEMBL
	Ribosomal_L23/L15e_core_dom_sf	UniProtKB/TrEMBL
	Ribosomal_L23/L25_CS	UniProtKB/TrEMBL
	Ribosomal_L23/L25_N	UniProtKB/TrEMBL
	Ribosomal_L25/23	UniProtKB/TrEMBL
KEGG Report	csab:103242630	UniProtKB/TrEMBL
NCBI Gene	RPL23A	ENTREZGENE
PANTHER	PTHR11620	UniProtKB/TrEMBL
Pfam	Ribosomal_L23	UniProtKB/TrEMBL
	Ribosomal_L23eN	UniProtKB/TrEMBL
PROSITE	RIBOSOMAL_L23	UniProtKB/TrEMBL
Superfamily-SCOP	SSF54189	UniProtKB/TrEMBL
UniProt	A0A0D9R464_CHLSB	UniProtKB/TrEMBL
	A0A0D9SA43	ENTREZGENE, UniProtKB/TrEMBL
	A0A0D9SAG1	ENTREZGENE, UniProtKB/TrEMBL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - CTD

RGD Manual Annotations