Symbol:
MIR708
Name:
microRNA mir-708 (Ensembl:microRNA 708)
RGD ID:
12163668
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
cfa-mir-708; microRNA 708
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
CanFam3.1 - Dog CanFam3.1 Assembly
Position:
Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 21 19,542,577 - 19,542,645 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 21 19,542,577 - 19,542,645 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 21 19,437,542 - 19,437,610 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 21 19,738,865 - 19,738,933 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 21 19,738,865 - 19,738,933 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 21 19,524,078 - 19,524,146 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 21 19,737,931 - 19,737,999 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 21 19,661,690 - 19,661,758 (+) NCBI UU_Cfam_GSD_1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
MIR708 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 21 19,542,577 - 19,542,645 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 21 19,542,577 - 19,542,645 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 21 19,437,542 - 19,437,610 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 21 19,738,865 - 19,738,933 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 21 19,738,865 - 19,738,933 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 21 19,524,078 - 19,524,146 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 21 19,737,931 - 19,737,999 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 21 19,661,690 - 19,661,758 (+) NCBI UU_Cfam_GSD_1.0
MIR708 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 79,402,022 - 79,402,109 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 79,402,022 - 79,402,109 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 79,113,066 - 79,113,153 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 78,790,713 - 78,790,800 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 11 76,422,187 - 76,422,274 (-) NCBI Celera Cytogenetic Map 11 q14.1 NCBI HuRef 11 75,409,416 - 75,409,503 (-) NCBI HuRef CHM1_1 11 78,995,903 - 78,995,990 (-) NCBI CHM1_1 T2T-CHM13v2.0 11 79,336,291 - 79,336,378 (-) NCBI T2T-CHM13v2.0
Mir708 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 95,898,631 - 95,898,739 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 95,898,631 - 95,898,739 (+) Ensembl GRCm39 Ensembl GRCm38 7 96,249,424 - 96,249,532 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 96,249,424 - 96,249,532 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 103,397,934 - 103,398,042 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Cytogenetic Map 7 E1 NCBI cM Map 7 52.54 NCBI
Mir708 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 160,011,158 - 160,011,245 (+) NCBI GRCr8 mRatBN7.2 1 150,599,876 - 150,599,963 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 150,599,876 - 150,599,963 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 158,583,701 - 158,583,788 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 165,763,871 - 165,763,958 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 158,637,325 - 158,637,412 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 161,221,246 - 161,221,333 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 161,221,246 - 161,221,333 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 167,436,243 - 167,436,330 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 1 148,707,350 - 148,707,437 (+) NCBI Celera Cytogenetic Map 1 q32 NCBI
MIR708 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 13,780,171 - 13,780,250 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 13,780,171 - 13,780,250 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 15,120,477 - 15,120,556 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCAFT00000039926
Type:
CODING
Position:
Dog Assembly Chr Position (strand) Source CanFam3.1 Ensembl 21 19,542,577 - 19,542,645 (+) Ensembl
Ensembl Acc Id:
ENSCAFT00845011245
Type:
CODING
Position:
Dog Assembly Chr Position (strand) Source ROS_Cfam_1.0 Ensembl 21 19,738,865 - 19,738,933 (+) Ensembl
RefSeq Acc Id:
NR_049273
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Dog Assembly Chr Position (strand) Source CanFam3.1 21 19,542,577 - 19,542,645 (+) NCBI Dog10K_Boxer_Tasha 21 19,437,542 - 19,437,610 (+) NCBI ROS_Cfam_1.0 21 19,738,865 - 19,738,933 (+) NCBI UMICH_Zoey_3.1 21 19,524,078 - 19,524,146 (+) NCBI UNSW_CanFamBas_1.0 21 19,737,931 - 19,737,999 (+) NCBI UU_Cfam_GSD_1.0 21 19,661,690 - 19,661,758 (+) NCBI
Sequence:
AAGGAGCTTACAATCTAGCTGGGGGTGAACGGCTTGCACATGAACGCAACTAGACTGTGAGCTTCTAGA
hide sequence
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-04-02
MIR708
microRNA mir-708
microRNA 708
Symbol and/or name change
5135510 APPROVED
