| 2232 | C3 | complement C3 | ENCODES a protein that exhibits lipid binding; antigen binding (ortholog); C5L2 anaphylatoxin chemotactic receptor binding (ortholog); INVOLVED IN complement activation; innervation; positive regulation of developmental growth; PARTICIPATES IN classical complement pathway; Chagas disease pathway; co agulation cascade pathway; ASSOCIATED WITH increased mechanical nociceptive threshold; ASSOCIATED WITH Acute Lung Injury; amyotrophic lateral sclerosis; anterior uveitis; FOUND IN extracellular space; cell surface (ortholog); classical-complement-pathway C3/C5 convertase complex (ortholog); INTERACTS WITH (S)-colchicine; 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane; 17alpha-ethynylestradiol | 9 | 2174412 | 2201339 | Rat | 713 | symbol , PhenoGen , name , description | gene, protein-coding, VALIDATED [RefSeq] |
| 149735372 | C3em1Kyo | complement C3; ZFN induced mutant 1, Kyo | ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cag ggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZFN systems were injected into the pronucleus of SHR/Izm embryos. The pups were identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg). | | | | Rat | | symbol , name , description | gene, allele |
| 19165134 | C3em1Linf | complement C3; CRISPR/Cas9 system induced mutant 1, Linf | ASSOCIATED WITH increased mechanical nociceptive threshold | | | | Rat | 2 | symbol , name , description | gene, allele |
| 735031 | Scgb2a1 | secretoglobin, family 2A, member 1 | ENCODES a protein that exhibits lipid binding (inferred); protein-containing complex binding (inferred); steroid binding (inferred); INVOLVED IN androgen receptor signaling pathway (ortholog); FOUND IN extracellular space (ortholog); INTERACTS WITH 17beta-hydroxy-5alpha-androstan-3-one; bisphenol A; N-(3,5-Dichlorophenyl)succinimide | 1 | 215922751 | 215926114 | Rat | 32 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 2136 | Apoc3 | apolipoprotein C3 | ENCODES a protein that exhibits high-density lipoprotein particle receptor binding (ortholog); lipase inhibitor activity (ortholog); phospholipid binding (ortholog); INVOLVED IN cellular response to glucose stimulus; lipoprotein transport; negative regulation of oxidative phosphorylation; PARTICIPAT ES IN altered lipoprotein metabolic pathway; lipoprotein metabolic pathway; eicosanoid signaling pathway via peroxisome proliferator-activated receptor gamma; ASSOCIATED WITH cholestasis; hyperthyroidism; hypothyroidism; FOUND IN extracellular space; chylomicron (ortholog); intermediate-density lipoprotein particle (ortholog); INTERACTS WITH (+)-schisandrin B; 1-nitropropane; 17beta-estradiol | 8 | 55428172 | 55430352 | Rat | 327 | symbol , PhenoGen , name | gene, protein-coding, VALIDATED [RefSeq] |
| 2322721 | Tex13c3 | TEX13 family member C3 | | X | 122017204 | 122018753 | Rat | | symbol , PhenoGen , name | gene, protein-coding, MODEL [RefSeq] |
| 1307693 | Kifc3 | kinesin family member C3 | ENCODES a protein that exhibits identical protein binding (ortholog); INVOLVED IN epithelial cell-cell adhesion (ortholog); Golgi organization (ortholog); microtubule-based process (ortholog); PARTICIPATES IN E-cadherin signaling pathway; FOUND IN centrosome (ortholog); Golgi apparatus (ortholog); k inesin complex (ortholog); INTERACTS WITH 17beta-estradiol; 2,2',5,5'-tetrachlorobiphenyl; 2,3,7,8-tetrachlorodibenzodioxine | 19 | 9831159 | 9926405 | Rat | 127 | symbol , old_gene_name , PhenoGen , name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1305950 | Mybpc3 | myosin binding protein C3 | ENCODES a protein that exhibits identical protein binding (ortholog); myosin binding (ortholog); myosin heavy chain binding (ortholog); INVOLVED IN cardiac muscle contraction; regulation of striated muscle contraction; heart morphogenesis (ortholog); PARTICIPATES IN dilated cardiomyopathy pathway; h ypertrophic cardiomyopathy pathway; ASSOCIATED WITH Animal Disease Models (ortholog); arrhythmogenic right ventricular cardiomyopathy (ortholog); arrhythmogenic right ventricular dysplasia 1 (ortholog); FOUND IN striated muscle myosin thick filament; A band (ortholog); cardiac myofibril (ortholog); INTERACTS WITH acetamide; amphetamine; bisphenol A | 3 | 97550974 | 97569216 | Rat | 270 | symbol , PhenoGen , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 735032 | Klk1c3 | kallikrein 1-related peptidase C3 | ENCODES a protein that exhibits hydrolase activity (inferred); peptidase activity (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); INTERACTS WITH bisphenol A; Cuprizon; Monobutylphthalate | 1 | 103808150 | 103811931 | Rat | 17 | symbol , PhenoGen , name | gene, protein-coding, VALIDATED [RefSeq] |
| 1560637 | Klrc3 | killer cell lectin like receptor C3 | ENCODES a protein that exhibits carbohydrate binding (inferred); PARTICIPATES IN antigen processing and presentation pathway; FOUND IN external side of plasma membrane (ortholog); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine | 4 | 164791102 | 164798758 | Rat | 37 | symbol , PhenoGen , name | gene, protein-coding, VALIDATED [RefSeq] |
| 708428 | Akr1c3 | aldo-keto reductase family 1, member C3 | ENCODES a protein that exhibits 17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase [NAD(P)+] activity; 15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (ortholog); alcohol dehydrogenase (NADP+) activity (ortholog); INVOLVED IN cellular response to follicle-stimulating hormone stimulus ; cellular response to forskolin; cellular response to gonadotropin-releasing hormone; PARTICIPATES IN isoprenoid metabolic pathway; acetylsalicylic acid pharmacodynamics pathway; antipyrine drug pathway; ASSOCIATED WITH polycystic ovary syndrome; pre-eclampsia; alcohol dependence (ortholog); FOUND IN cytosol; cytoplasm (ortholog); nucleus (ortholog); INTERACTS WITH (20S)-20-hydroxypregn-4-en-3-one; 1,1,1-trichloro-2,2-bis(4-hydroxyphenyl)ethane; 1-naphthyl isothiocyanate | 17 | 71020884 | 71037779 | Rat | 559 | symbol , old_gene_name , PhenoGen , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1564865 | Akr1c3l1 | aldo-keto reductase family 1 member C3-like 1 | ENCODES a protein that exhibits oxidoreductase activity (inferred); ASSOCIATED WITH Experimental Liver Cirrhosis; INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 4,4'-diaminodiphenylmethane | 17 | 70745496 | 70791411 | Rat | 36 | symbol , PhenoGen , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 708518 | Dnajc3 | DnaJ heat shock protein family (Hsp40) member C3 | ENCODES a protein that exhibits misfolded protein binding (ortholog); protein kinase binding (ortholog); protein kinase inhibitor activity (ortholog); INVOLVED IN cellular response to cold (ortholog); negative regulation of apoptotic process (ortholog); negative regulation of endoplasmic reticulum s tress-induced eIF2 alpha phosphorylation (ortholog); PARTICIPATES IN Endoplasmic Reticulum-associated degradation pathway; influenza A pathway; ASSOCIATED WITH Combined Cerebellar and Peripheral Ataxia with Hearing Loss and Diabetes Mellitus (ortholog); genetic disease (ortholog); prostate cancer (ortholog); FOUND IN smooth endoplasmic reticulum; cytoplasm (ortholog); cytosol (ortholog); INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine | 15 | 102432667 | 102475643 | Rat | 238 | symbol , PhenoGen , name | gene, protein-coding, VALIDATED [RefSeq] |
| 9229390 | LOC103693662 | ATP synthase F(0) complex subunit C3, mitochondrial pseudogene | | 15 | 39605308 | 39606818 | Rat | | name | gene, pseudo, MODEL [RefSeq] |
| 1597239 | Psma2-ps2 | proteasome 20S subunit alpha 2, pseudogene 2 | | X | 7914041 | 7914733 | Rat | | old_gene_name | gene, pseudo, MODEL [RefSeq] |
| 1359364 | Hba-a2 | hemoglobin alpha, adult chain 2 | ENCODES a protein that exhibits G protein-coupled receptor binding; haptoglobin binding (ortholog); peroxidase activity (ortholog); INVOLVED IN response to estradiol; hydrogen peroxide catabolic process (ortholog); inflammatory response (ortholog); ASSOCIATED WITH alpha thalassemia (ortholog); Alpha -Thalassemia 2 (ortholog); Alpha-Thalassemia-2, Nondeletional (ortholog); FOUND IN extracellular space (ortholog); haptoglobin-hemoglobin complex (ortholog); hemoglobin complex (ortholog); INTERACTS WITH 1,1-dichloroethene; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 10 | 15828291 | 15829138 | Rat | 205 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 61842 | Psma2 | proteasome 20S subunit alpha 2 | INVOLVED IN proteasomal protein catabolic process (ortholog); proteasome-mediated ubiquitin-dependent protein catabolic process (ortholog); regulation of proteasomal protein catabolic process (ortholog); PARTICIPATES IN ubiquitin/proteasome degradation pathway; ASSOCIATED WITH heart disease (ortholo g); osteoporosis (ortholog); FOUND IN cytoplasm (ortholog); nucleus (ortholog); P-body (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene | 17 | 55250054 | 55260441 | Rat | 165 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 69348 | Shc3 | SHC adaptor protein 3 | ENCODES a protein that exhibits phosphotyrosine residue binding (ortholog); INVOLVED IN learning or memory (ortholog); synaptic transmission, glutamatergic (ortholog); PARTICIPATES IN chemokine mediated signaling pathway; chronic myeloid leukemia pathway; epidermal growth factor/neuregulin signaling pathway; ASSOCIATED WITH Ependymomas (ortholog); FOUND IN nucleoplasm (ortholog); INTERACTS WITH 1,3-dinitrobenzene; 17alpha-ethynylestradiol; 3H-1,2-dithiole-3-thione | 17 | 13803980 | 13924433 | Rat | 118 | symbol , old_gene_name , PhenoGen | gene, protein-coding, PROVISIONAL [RefSeq] |
| 620746 | Pcdhgc3 | protocadherin gamma subfamily C, 3 | ENCODES a protein that exhibits calcium ion binding (inferred); INVOLVED IN negative regulation of neuron apoptotic process (ortholog); synapse organization (ortholog); FOUND IN membrane (ortholog); INTERACTS WITH 17beta-estradiol; 6-propyl-2-thiouracil; acetamide | 18 | 29884245 | 29919095 | Rat | 64 | symbol , old_gene_name , PhenoGen | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2498 | Cfd | complement factor D | ENCODES a protein that exhibits endopeptidase activity; serine-type endopeptidase activity (ortholog); INVOLVED IN complement activation, alternative pathway; Notch signaling pathway; response to bacterium (ortholog); PARTICIPATES IN coagulation cascade pathway; complement system pathway; Staphyloco ccus aureus infection pathway; ASSOCIATED WITH arthus reaction; Experimental Diabetes Mellitus; obesity; FOUND IN extracellular space; INTERACTS WITH 1,2-dimethylhydrazine; 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine | 7 | 10463773 | 10465496 | Rat | 244 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1304823 | Kdm8 | lysine demethylase 8 | ENCODES a protein that exhibits aminopeptidase activity (ortholog); chromatin binding (ortholog); endopeptidase activity (ortholog); INVOLVED IN circadian regulation of gene expression (ortholog); fibroblast proliferation (ortholog); G2/M transition of mitotic cell cycle (ortholog); PARTICIPATES IN histone modification pathway; ASSOCIATED WITH breast cancer (ortholog); Coffin-Siris syndrome (ortholog); hepatocellular carcinoma (ortholog); FOUND IN nucleus (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; amitrole | 1 | 189444527 | 189459507 | Rat | 116 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1311545 | Polr3c | RNA polymerase III subunit C | ENCODES a protein that exhibits single-stranded DNA binding (ortholog); INVOLVED IN positive regulation of innate immune response (ortholog); positive regulation of interferon-beta production (ortholog); termination of RNA polymerase III transcription (ortholog); PARTICIPATES IN RNA polymerase III t ranscription pathway; purine metabolic pathway; pyrimidine metabolic pathway; ASSOCIATED WITH lymphopenia (ortholog); neutropenia (ortholog); FOUND IN nucleoplasm (ortholog); RNA polymerase III complex (ortholog); INTERACTS WITH 2,4-dinitrotoluene; 4-amino-2,6-dinitrotoluene; bisphenol A | 2 | 186935038 | 186950962 | Rat | 81 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1307568 | Rac2 | Rac family small GTPase 2 | ENCODES a protein that exhibits GTP binding (ortholog); GTPase activity (ortholog); protein kinase regulator activity (ortholog); INVOLVED IN actin cytoskeleton organization; bone resorption; actin filament organization (ortholog); PARTICIPATES IN B cell receptor signaling pathway; ceramide signalin g pathway; chemokine mediated signaling pathway; ASSOCIATED WITH acute myeloid leukemia (ortholog); Chronic Periodontitis (ortholog); Disease Progression (ortholog); FOUND IN actin filament (ortholog); cytoplasm (ortholog); cytosol (ortholog); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine | 7 | 111981825 | 112009201 | Rat | 274 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 619755 | Rac1 | Rac family small GTPase 1 | ENCODES a protein that exhibits ATPase binding; GTP binding; GTPase activity; INVOLVED IN actin cytoskeleton organization; actin filament organization; bone resorption; PARTICIPATES IN Rho/Rac/Cdc42 mediated signaling pathway; Arf family mediated signaling pathway; azathioprine pharmacodynamics path way; ASSOCIATED WITH congestive heart failure; Left Ventricular Hypertrophy; autosomal dominant intellectual developmental disorder 48 (ortholog); FOUND IN cytosol; GABA-ergic synapse; Golgi membrane; INTERACTS WITH 11-deoxycorticosterone; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 12 | 16150411 | 16170864 | Rat | 639 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1590052 | Rac3 | Rac family small GTPase 3 | ENCODES a protein that exhibits calcium-dependent protein binding (ortholog); GTPase activity (ortholog); INVOLVED IN actin cytoskeleton organization (ortholog); cell projection assembly (ortholog); cerebral cortex GABAergic interneuron development (ortholog); ASSOCIATED WITH acute myeloid leukemia (ortholog); basal cell carcinoma (ortholog); Desbuquois dysplasia (ortholog); FOUND IN growth cone; cell periphery (ortholog); endomembrane system (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 3-chloropropane-1,2-diol | 10 | 106501133 | 106503569 | Rat | 158 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 3521 | Art2b | ADP-ribosyltransferase 2b | ENCODES a protein that exhibits hydrolase activity, acting on glycosyl bonds (ortholog); NAD+-protein-arginine ADP-ribosyltransferase activity (ortholog); INVOLVED IN NAD+ catabolic process (ortholog); FOUND IN external side of plasma membrane (ortholog); INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine; 3H-1,2-dithiole-3-thione | 1 | 165368623 | 165386280 | Rat | 32 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 628834 | Art5 | ADP-ribosyltransferase 5 | ENCODES a protein that exhibits NAD+ nucleosidase activity (ortholog); NAD+-protein-arginine ADP-ribosyltransferase activity (ortholog); FOUND IN membrane (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acrylamide | 1 | 165885344 | 165895306 | Rat | 60 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 620052 | Atp5mc3 | ATP synthase membrane subunit c locus 3 | ENCODES a protein that exhibits ligand-gated channel activity; INVOLVED IN pore complex assembly; response to (R)-carnitine; response to ethanol; PARTICIPATES IN Alzheimer's disease pathway; Huntington's disease pathway; oxidative phosphorylation pathway; ASSOCIATED WITH COVID-19 (ortholog); early-o nset dystonia and/or spastic paraplegia (ortholog); genetic disease (ortholog); FOUND IN cation channel complex; mitochondrion (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene | 3 | 79218014 | 79220664 | Rat | 117 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1566313 | Mug6 | murinoglobulin 6 | ENCODES a protein that exhibits endopeptidase inhibitor activity (inferred); peptidase inhibitor activity (inferred); serine-type endopeptidase inhibitor activity (inferred); INVOLVED IN eye development (ortholog); ASSOCIATED WITH anterior segment dysgenesis (ortholog); anterior segment dysgenesis 8 (ortholog); breast ductal carcinoma (ortholog); FOUND IN extracellular region (inferred); extracellular space (inferred); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; acetamide | 4 | 157004905 | 157085187 | Rat | 56 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 620537 | C3ar1 | complement C3a receptor 1 | ENCODES a protein that exhibits complement component C3a binding; complement component C3a receptor activity; G protein-coupled receptor activity (o rtholog); INVOLVED IN positive regulation of cell migration; positive regulation of cytosolic calcium ion concentration; positive regulation of DNA biosynthetic process; PARTICIPATES IN coagulation cascade pathway; complement system pathway; Staphylococcus aureus infection pathway; ASSOCIATED WITH adult respiratory distress syndrome; asthma; lung disease; FOUND IN plasma membrane (ortholog); INTERACTS WITH 1,3-dinitrobenzene; 17alpha-ethynylestradiol; 17beta-estradiol | 4 | 157747419 | 157756609 | Rat | 180 | symbol , old_gene_name , PhenoGen , name , description , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1563512 | Rc3h1 | ring finger and CCCH-type domains 1 | ENCODES a protein that exhibits CCR4-NOT complex binding (ortholog); double-stranded RNA binding (ortholog); miRNA binding (ortholog); INVOLVED IN 3'-UTR-mediated mRNA destabilization (ortholog); B cell homeostasis (ortholog); lymph node development (ortholog); ASSOCIATED WITH Familial Hemophagocyti c Lymphohistiocytosis 6 (ortholog); peripheral T-cell lymphoma (ortholog); systemic lupus erythematosus (ortholog); FOUND IN cytoplasm (ortholog); cytoplasmic stress granule (ortholog); cytosol (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A | 13 | 75707098 | 75779114 | Rat | 172 | symbol , old_gene_name , PhenoGen , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1359229 | Nt5c3b | 5'-nucleotidase, cytosolic IIIB | ENCODES a protein that exhibits hydrolase activity (inferred); magnesium ion binding (inferred); metal ion binding (inferred); INVOLVED IN nucleotide metabolic process (inferred); FOUND IN cytoplasm (inferred); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 10 | 85859509 | 85876731 | Rat | 54 | symbol , old_gene_name , PhenoGen , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1561099 | Zc3hc1 | zinc finger, C3HC-type containing 1 | ENCODES a protein that exhibits protein kinase binding (ortholog); ASSOCIATED WITH coronary artery disease (ortholog); Coronary Disease (ortholog); type 2 diabetes mellitus (ortholog); FOUND IN nuclear membrane (ortholog); nuclear pore nuclear basket (ortholog); nucleoplasm (ortholog); INTERACTS WIT H 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 4 | 59957402 | 59979336 | Rat | 65 | symbol , old_gene_name , PhenoGen , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1306287 | Zfc3h1 | zinc finger, C3H1-type containing | INVOLVED IN RNA processing (inferred); ASSOCIATED WITH Dwarfism (ortholog); juvenile rheumatoid arthritis (ortholog); FOUND IN MTREC complex (ortholog); nucleolus (ortholog); nucleus (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; aflatoxin B1; azoxystrobin | 7 | 52894417 | 52950755 | Rat | 81 | symbol , old_gene_name , PhenoGen , name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1595783 | Dnajc30 | DnaJ heat shock protein family (Hsp40) member C30 | INVOLVED IN brain development (ortholog); regulation of mitochondrial ATP synthesis coupled proton transport (ortholog); ASSOCIATED WITH fundus dystrophy (ortholog); Leber Optic Atrophy, Susceptibility To (ortholog); Nuclear Type Mitochondrial Complex I Deficiency 38 (ortholog); FOUND IN mitochondri al inner membrane (ortholog); mitochondrion (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 6-propyl-2-thiouracil | 12 | 27264861 | 27265940 | Rat | 67 | symbol , PhenoGen , name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1311084 | C3h9orf50 | similar to human chromosome 9 open reading frame 50 | FOUND IN cytoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil | 3 | 34477535 | 34484791 | Rat | 22 | symbol , old_gene_name , PhenoGen , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1305178 | C3h9orf78 | similar to human chromosome 9 open reading frame 78 | ENCODES a protein that exhibits U5 snRNA binding (ortholog); INVOLVED IN mRNA cis splicing, via spliceosome (ortholog); regulation of homologous chromosome segregation (ortholog); FOUND IN chromosome, centromeric region (ortholog); nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH bisphenol A; thioacetamide; aristolochic acid A (ortholog) | 3 | 34662011 | 34670282 | Rat | 38 | symbol , old_gene_name , PhenoGen , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1563222 | C3h11orf91 | similar to human chromosome 11 open reading frame 91 | INTERACTS WITH 6-propyl-2-thiouracil; acrylamide; bisphenol A | 3 | 110934488 | 110941511 | Rat | 12 | symbol , old_gene_name , PhenoGen , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1564664 | C3h11orf96 | similar to human chromosome 11 open reading frame 96 | ASSOCIATED WITH intellectual disability (ortholog); FOUND IN cytoplasm (inferred); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 4,4'-sulfonyldiphenol; bisphenol A | 3 | 100375474 | 100376717 | Rat | 89 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1359583 | C3h15orf48 | similar to human chromosome 15 open reading frame 48 | FOUND IN mitochondrion (ortholog); nucleus (ortholog); INTERACTS WITH bisphenol A; (+)-catechin (ortholog); (-)-epigallocatechin 3-gallate (ortholog) | 3 | 130173535 | 130177088 | Rat | 78 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1583955 | C3h15orf62 | similar to human chromosome 15 open reading frame 62 | ASSOCIATED WITH colorectal cancer (ortholog); FOUND IN mitochondrion (ortholog); INTERACTS WITH bisphenol A; 17beta-estradiol (ortholog); 2-hydroxypropanoic acid (ortholog) | 3 | 126618025 | 126621250 | Rat | 33 | symbol , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1559448 | C3h20orf96 | similar to human chromosome 20 open reading frame 96 | INTERACTS WITH bisphenol A; 4-hydroxyphenyl retinamide (ortholog); aflatoxin B1 (ortholog) | 3 | 161337376 | 161368007 | Rat | 17 | symbol , UniProt , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1561517 | C3h20orf144 | similar to human chromosome 20 open reading frame 144 | INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; genistein | 3 | 163514340 | 163515531 | Rat | 8 | symbol , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 7514905 | C3h20orf173 | similar to human chromosome 20 open reading frame 173 | ENCODES a protein that exhibits sialyltransferase activity (inferred); INTERACTS WITH aflatoxin B1 (ortholog); cadmium atom (ortholog); cadmium dichloride (ortholog) | 3 | 164972748 | 164985195 | Rat | 10 | symbol , PhenoGen | gene, protein-coding, MODEL [RefSeq] |
| 41309000 | Dnajc30-ps1 | DnaJ heat shock protein family (Hsp40) member C30, pseudogene 1 | | 7 | 31855314 | 31859413 | Rat | | symbol , PhenoGen , name | gene, pseudo, MODEL [RefSeq] |
| 1309401 | Cend1 | cell cycle exit and neuronal differentiation 1 | INVOLVED IN adult walking behavior (ortholog); cerebellar granular layer maturation (ortholog); cerebellar Purkinje cell differentiation (ortholog); FOUND IN mitochondrion (ortholog); vesicle (ortholog); INTERACTS WITH acrylamide; bisphenol A; thioacetamide | 1 | 205954713 | 205957710 | Rat | 64 | old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 619793 | Rapgef1 | Rap guanine nucleotide exchange factor 1 | ENCODES a protein that exhibits guanyl-nucleotide exchange factor activity (ortholog); INVOLVED IN positive regulation of ERK1 and ERK2 cascade; positive regulation of Fc receptor mediated stimulatory signaling pathway; positive regulation of neuron projection development; PARTICIPATES IN c-Jun N-te rminal kinases MAPK signaling pathway; E-cadherin signaling pathway; erythropoietin signaling pathway; ASSOCIATED WITH anti-basement membrane glomerulonephritis; mesangial proliferative glomerulonephritis; Monoclonal B-Cell Lymphocytosis (ortholog); FOUND IN perinuclear region of cytoplasm; phagocytic vesicle membrane; protein-containing complex; INTERACTS WITH 2,6-dinitrotoluene; ammonium chloride; bisphenol A | 3 | 33296211 | 33414119 | Rat | 129 | old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 628717 | Klhl12 | kelch-like family member 12 | ENCODES a protein that exhibits identical protein binding (ortholog); INVOLVED IN COPII vesicle coating (ortholog); endoplasmic reticulum to Golgi vesicle-mediated transport (ortholog); neural crest cell development (ortholog); PARTICIPATES IN Wnt signaling, canonical pathway; FOUND IN COPII vesicle coat (ortholog); COPII-coated ER to Golgi transport vesicle (ortholog); Cul3-RING ubiquitin ligase complex (ortholog); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine | 13 | 48451920 | 48485638 | Rat | 100 | old_gene_name , UniProt , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 728319 | Rapgef1_v1 | Rap guanine nucleotide exchange factor 1, variant 1 | | | | | Rat | | old_gene_symbol | gene, splice |
| 728306 | Rapgef1_v2 | Rap guanine nucleotide exchange factor 1, variant 2 | | | | | Rat | | old_gene_symbol | gene, splice |
| 727841 | Ccdc50 | coiled-coil domain containing 50 | ENCODES a protein that exhibits ubiquitin protein ligase binding (ortholog); INVOLVED IN sensory perception of sound (ortholog); ASSOCIATED WITH autosomal dominant nonsyndromic deafness 44 (ortholog); B-Cell Chronic Lymphocytic Leukemia (ortholog); mantle cell lymphoma (ortholog); FOUND IN cytoplasm (ortholog); cytosol (ortholog); microtubule cytoskeleton (ortholog); INTERACTS WITH 1,2-dimethylhydrazine; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 11 | 86837624 | 86900164 | Rat | 95 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1310223 | Lpcat3 | lysophosphatidylcholine acyltransferase 3 | ENCODES a protein that exhibits 1-acylglycerophosphocholine O-acyltransferase activity (ortholog); 1-acylglycerophosphoethanolamine O-acyltransferase activity (ortholog); 1-acylglycerophosphoserine O-acyltransferase activity (ortholog); INVOLVED IN chylomicron assembly (ortholog); endoplasmic reticu lum membrane organization (ortholog); intestinal stem cell homeostasis (ortholog); PARTICIPATES IN glycerophospholipid metabolic pathway; FOUND IN endoplasmic reticulum membrane (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene | 4 | 159154690 | 159196176 | Rat | 183 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1549709 | Vom1r72 | vomeronasal 1 receptor 72 | ENCODES a protein that exhibits G protein-coupled receptor activity (inferred); pheromone receptor activity (inferred); INVOLVED IN G protein-coupled receptor signaling pathway (inferred); response to pheromone (inferred); sensory perception of chemical stimulus (inferred); FOUND IN membrane (inferr ed); plasma membrane (inferred); INTERACTS WITH bisphenol A; trichloroethene | 4 | 87956895 | 87957794 | Rat | 13 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1549715 | Vom1r73 | vomeronasal 1 receptor 73 | ENCODES a protein that exhibits G protein-coupled receptor activity (inferred); pheromone receptor activity (inferred); INVOLVED IN G protein-coupled receptor signaling pathway (inferred); response to pheromone (inferred); sensory perception of chemical stimulus (inferred); FOUND IN membrane (inferr ed); plasma membrane (inferred); INTERACTS WITH 6-propyl-2-thiouracil; atrazine; glyphosate | 4 | 88014940 | 88015857 | Rat | 14 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1359218 | Vom1r77 | vomeronasal 1 receptor 77 | ENCODES a protein that exhibits G protein-coupled receptor activity (inferred); pheromone receptor activity (inferred); INVOLVED IN G protein-coupled receptor signaling pathway (inferred); response to pheromone (inferred); sensory perception of chemical stimulus (inferred); FOUND IN membrane (inferr ed); plasma membrane (inferred); INTERACTS WITH 6-propyl-2-thiouracil; Cuprizon | 4 | 88131563 | 88132480 | Rat | 13 | old_gene_name , old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1549704 | Vom1r78 | vomeronasal 1 receptor 78 | ENCODES a protein that exhibits G protein-coupled receptor activity (inferred); pheromone receptor activity (inferred); INVOLVED IN G protein-coupled receptor signaling pathway (inferred); response to pheromone (inferred); sensory perception of chemical stimulus (inferred); FOUND IN membrane (inferr ed); plasma membrane (inferred); INTERACTS WITH 6-propyl-2-thiouracil; Cuprizon; glycidol | 4 | 88202212 | 88203129 | Rat | 13 | old_gene_name , old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1359257 | Vom1r79 | vomeronasal 1 receptor 79 | ENCODES a protein that exhibits G protein-coupled receptor activity (inferred); pheromone receptor activity (inferred); INVOLVED IN G protein-coupled receptor signaling pathway (inferred); response to pheromone (inferred); sensory perception of chemical stimulus (inferred); FOUND IN membrane (inferr ed); plasma membrane (inferred) | 4 | 88240931 | 88241842 | Rat | 9 | old_gene_name , old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1549747 | Vom1r80 | vomeronasal 1 receptor 80 | INTERACTS WITH vinclozolin | 4 | 88285097 | 88285996 | Rat | 1 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1565059 | C2h3orf33 | similar to human chromosome 3 open reading frame 33 | INVOLVED IN negative regulation of ERK1 and ERK2 cascade (ortholog); FOUND IN extracellular space (ortholog); mitochondrion (ortholog); INTERACTS WITH 2,3,7,8-Tetrachlorodibenzofuran; acrylamide; bisphenol A | 2 | 150522758 | 150554007 | Rat | 41 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1307461 | C8h3orf18 | similar to human chromosome 3 open reading frame 18 | INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acrylamide | 8 | 116891081 | 116901122 | Rat | 31 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1359720 | Cfap20dc | CFAP20 domain containing | INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; paracetamol | 15 | 18661562 | 18907226 | Rat | 30 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1310335 | Cip2a | cellular inhibitor of PP2A | ENCODES a protein that exhibits protein homodimerization activity (ortholog); protein phosphatase inhibitor activity (ortholog); INVOLVED IN broken chromosome clustering (ortholog); chromosome organization (ortholog); DNA damage response (ortholog); FOUND IN chromosome (ortholog); cytoplasm (ortholo g); cytosol (ortholog); INTERACTS WITH 1-naphthyl isothiocyanate; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 11 | 65255123 | 65285914 | Rat | 83 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1304861 | Cuedc1 | CUE domain containing 1 | ENCODES a protein that exhibits ubiquitin binding (inferred); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; acetamide; bisphenol A | 10 | 73389798 | 73484914 | Rat | 59 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1359206 | Dalrd3 | DALR anticodon binding domain containing 3 | ENCODES a protein that exhibits tRNA binding (ortholog); INVOLVED IN tRNA C3-cytosine methylation (ortholog); ASSOCIATED WITH developmental and epileptic encephalopathy 86 (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenz odioxine; 4,4'-sulfonyldiphenol; 6-propyl-2-thiouracil | 8 | 118142009 | 118147082 | Rat | 71 | description , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1305478 | Elp6 | elongator acetyltransferase complex subunit 6 | INVOLVED IN apoptotic process (ortholog); autophagosome maturation (ortholog); autophagy (ortholog); FOUND IN cytosol (ortholog); elongator holoenzyme complex (ortholog); nucleus (ortholog); INTERACTS WITH 2,4-dinitrotoluene; 2,6-dinitrotoluene; 4-amino-2,6-dinitrotoluene | 8 | 119158380 | 119173483 | Rat | 97 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1309643 | Foxk1 | forkhead box K1 | ENCODES a protein that exhibits 14-3-3 protein binding (ortholog); DNA binding (ortholog); DNA-binding transcription factor activity (ortholog); INVOLVED IN canonical glycolysis (ortholog); intracellular glucose homeostasis (ortholog); negative regulation of autophagy (ortholog); FOUND IN cytoplasm (ortholog); nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; acetamide; bisphenol A | 12 | 17223599 | 17288564 | Rat | 146 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1311223 | Gk5 | glycerol kinase 5 | ENCODES a protein that exhibits glycerol kinase activity (ortholog); INVOLVED IN glycerol-3-phosphate biosynthetic process (ortholog); FOUND IN cytoplasm (ortholog); mitochondrion (ortholog); INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,3,7,8-tetrachlorodibenzodioxine | 8 | 105562018 | 105630975 | Rat | 63 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1307440 | Lrrc58 | leucine rich repeat containing 58 | ENCODES a protein that exhibits ubiquitin-like ligase-substrate adaptor activity (ortholog); INVOLVED IN proteasome-mediated ubiquitin-dependent protein catabolic process (ortholog); regulation of taurine biosynthetic process (ortholog); FOUND IN Cul5-RING ubiquitin ligase complex (ortholog); INTERA CTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 11 | 76355987 | 76368309 | Rat | 78 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1305148 | Marchf1 | membrane associated ring-CH-type finger 1 | ENCODES a protein that exhibits MHC protein binding (ortholog); ubiquitin protein ligase activity (ortholog); ubiquitin-protein transferase activity (ortholog); INVOLVED IN antigen processing and presentation of peptide antigen via MHC class II (ortholog); immune response (ortholog); protein polyubi quitination (ortholog); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN early endosome membrane (ortholog); endoplasmic reticulum membrane (ortholog); endosome (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 4,4'-diaminodiphenylmethane | 16 | 28022159 | 28880872 | Rat | 99 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1311692 | Marchf10 | membrane associated ring-CH-type finger 10 | ENCODES a protein that exhibits ligase activity (inferred); metal ion binding (inferred); transferase activity (inferred); INVOLVED IN protein ubiquitination (inferred); INTERACTS WITH 17beta-estradiol 3-benzoate; alpha-Zearalanol; bisphenol A | 10 | 90832647 | 90975700 | Rat | 30 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1306395 | Marchf2 | membrane associated ring-CH-type finger 2 | ENCODES a protein that exhibits ubiquitin protein ligase activity (ortholog); INVOLVED IN antibacterial innate immune response (ortholog); antiviral innate immune response (ortholog); positive regulation of lysosomal protein catabolic process (ortholog); FOUND IN cytoplasm (ortholog); cytoplasmic ve sicle (ortholog); endoplasmic reticulum (ortholog); INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 7 | 15183931 | 15209988 | Rat | 121 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1590797 | Marchf4 | membrane associated ring-CH-type finger 4 | ENCODES a protein that exhibits ubiquitin-protein transferase activity (ortholog); INVOLVED IN protein ubiquitination (inferred); ASSOCIATED WITH frontotemporal dementia (ortholog); FOUND IN Golgi stack (ortholog); trans-Golgi network (ortholog); INTERACTS WITH 6-propyl-2-thiouracil; endosulfan; 17b eta-estradiol (ortholog) | 9 | 81527703 | 81647448 | Rat | 62 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1308993 | Marchf7 | membrane associated ring-CH-type finger 7 | ENCODES a protein that exhibits enzyme binding (ortholog); MDM2/MDM4 family protein binding (ortholog); ubiquitin binding (ortholog); INVOLVED IN negative regulation of cilium assembly (ortholog); negative regulation of DNA damage response, signal transduction by p53 class mediator (ortholog); negat ive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (ortholog); FOUND IN centrosome (ortholog); cytosol (ortholog); nucleus (ortholog); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 3 | 65090640 | 65128768 | Rat | 110 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1309339 | Marchf8 | membrane associated ring-CH-type finger 8 | ENCODES a protein that exhibits MHC class II protein binding (ortholog); ubiquitin protein ligase activity (ortholog); ubiquitin-protein transferase activity (ortholog); INVOLVED IN antigen processing and presentation of peptide antigen via MHC class II (ortholog); negative regulation of MHC class I I biosynthetic process (ortholog); proteasome-mediated ubiquitin-dependent protein catabolic process (ortholog); ASSOCIATED WITH Esophageal Neoplasms (ortholog); FOUND IN endosome (ortholog); lysosome (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; bisphenol A | 4 | 151086076 | 151203205 | Rat | 95 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1308356 | N4bp3 | Nedd4 binding protein 3 | INVOLVED IN nervous system development (inferred); FOUND IN cytoplasmic vesicle (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; aflatoxin B1 | 10 | 36400053 | 36407609 | Rat | 71 | old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1359633 | Neurl3 | neuralized E3 ubiquitin protein ligase 3 | ENCODES a protein that exhibits ubiquitin protein ligase activity (ortholog); INVOLVED IN positive regulation of proteasomal protein catabolic process (ortholog); protein ubiquitination (ortholog); FOUND IN cytoplasm (ortholog); INTERACTS WITH (+)-schisandrin B; 1-naphthyl isothiocyanate; 17alpha-et hynylestradiol | 9 | 45990373 | 45998470 | Rat | 124 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1564811 | Pp2d1 | protein phosphatase 2C-like domain containing 1 | ENCODES a protein that exhibits phosphoprotein phosphatase activity (inferred); protein serine/threonine phosphatase activity (inferred); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; acetamide; bisphenol A | 9 | 6749236 | 6770235 | Rat | 29 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1311458 | Rmp64 | ribonuclease MRP subunit p64 | INVOLVED IN negative regulation of neuron differentiation (ortholog); positive regulation of Notch signaling pathway (ortholog); RNA processing (ortholog); ASSOCIATED WITH anauxetic dysplasia 3 (ortholog); microcephaly (ortholog); FOUND IN nucleolus (ortholog); nucleoplasm (ortholog); nucleus (ortho log); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; bisphenol A | 11 | 69464263 | 69476429 | Rat | 48 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1307807 | Rnf19a | ring finger protein 19A, RBR E3 ubiquitin protein ligase | ENCODES a protein that exhibits metal ion binding (inferred); transferase activity (inferred); ubiquitin protein ligase activity (inferred); INVOLVED IN regulation of protein catabolic process at postsynapse, modulating synaptic transmission (ortholog); ASSOCIATED WITH multiple sclerosis (ortholog); FOUND IN glutamatergic synapse (ortholog); hippocampal mossy fiber to CA3 synapse (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene; 2,6-dinitrotoluene | 7 | 69310947 | 69350567 | Rat | 113 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1306092 | Rnf6 | ring finger protein 6 | ENCODES a protein that exhibits DNA binding (ortholog); nuclear androgen receptor binding (ortholog); ubiquitin protein ligase activity (ortholog); INVOLVED IN negative regulation of axon extension (ortholog); positive regulation of DNA-templated transcription (ortholog); protein K27-linked ubiquiti nation (ortholog); ASSOCIATED WITH Esophageal Neoplasms (ortholog); esophagus squamous cell carcinoma (ortholog); hepatocellular carcinoma (ortholog); FOUND IN axon (ortholog); cytoplasm (ortholog); nuclear membrane (ortholog); INTERACTS WITH 1,2-dimethylhydrazine; 1,3-dinitrobenzene; 2,3,7,8-tetrachlorodibenzodioxine | 12 | 13929160 | 13940663 | Rat | 122 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 1311440 | Sccpdh | saccharopine dehydrogenase (putative) | ENCODES a protein that exhibits oxidoreductase activity (inferred); FOUND IN lipid droplet (ortholog); midbody (ortholog); mitochondrion (ortholog); INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene | 13 | 93932086 | 93953840 | Rat | 90 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1561851 | Slc25a36l1 | solute carrier family 25 (pyrimidine nucleotide carrier ), member 36-like 1 | ENCODES a protein that exhibits pyrimidine nucleotide transmembrane transporter activity (inferred); INVOLVED IN nucleotide transport (inferred); transmembrane transport (inferred); FOUND IN membrane (inferred); mitochondrial inner membrane (inferred); INTERACTS WITH 6-propyl-2-thiouracil; amitrole; amphetamine | 19 | 49851197 | 49853288 | Rat | 16 | old_gene_name , old_gene_symbol | gene, protein-coding, MODEL [RefSeq] |
| 1564659 | Vsig4 | V-set and immunoglobulin domain containing 4 | ENCODES a protein that exhibits complement component C3b binding (ortholog); INVOLVED IN negative regulation of complement activation, alternative pathway (ortholog); negative regulation of interleukin-2 production (ortholog ); negative regulation of T cell proliferation (ortholog); ASSOCIATED WITH acute myeloid leukemia (ortholog); COVID-19 (ortholog); hepatocellular carcinoma (ortholog); FOUND IN protein-containing complex (ortholog); INTERACTS WITH 3-chloropropane-1,2-diol; acetamide; aflatoxin B1 | X | 65154422 | 65179708 | Rat | 73 | old_gene_name , description , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1559581 | Zfp36l3 | zinc finger protein 36, C3H type-like 3 | ENCODES a protein that exhibits metal ion binding (inferred); mRNA 3'-UTR binding (inferred); mRNA binding (inferred); INVOLVED IN mRNA transport (inferred); negative regulation of translation (inferred); FOUND IN P-body (inferred); INTERACTS WITH benzo[a]pyrene; bisphenol A; cefaloridine | X | 138573127 | 138576456 | Rat | 16 | old_gene_name , name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1589960 | Cimip1 | ciliary microtubule inner protein 1 | FOUND IN cilium (ortholog); INTERACTS WITH bisphenol A; benzo[a]pyrene (ortholog); methotrexate (ortholog) | 3 | 182733242 | 182740733 | Rat | 6 | old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2977 | Klrc2 | killer cell lectin like receptor C2 | ENCODES a protein that exhibits activating MHC class Ib receptor activity (ortholog); MHC class I protein complex binding (ortholog); protein antigen binding (ortholog); INVOLVED IN natural killer cell mediated immunity (ortholog); positive regulation of natural killer cell degranulation (ortholog); positive regulation of natural killer cell mediated cytotoxicity (ortholog); PARTICIPATES IN antigen processing and presentation pathway; ASSOCIATED WITH Creutzfeldt-Jakob disease (ortholog); FOUND IN external side of plasma membrane (ortholog); plasma membrane (ortholog); receptor complex (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 17beta-estradiol 3-benzoate | 4 | 164808722 | 164819865 | Rat | 48 | ensembl_gene_symbol , ensembl_full_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2311609 | Mettl9 | methyltransferase 9, His-X-His N1(pi)-histidine | ENCODES a protein that exhibits protein-L-histidine N-pros-methyltransferase activity (ortholog); ASSOCIATED WITH COVID-19 (ortholog); FOUND IN endoplasmic reticulum (ortholog); mitochondrion (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acetamide | 1 | 185006953 | 185054359 | Rat | 84 | UniProt | gene, protein-coding, VALIDATED [RefSeq] |
| 1559945 | Marchf11 | membrane associated ring-CH-type finger 11 | ENCODES a protein that exhibits metal ion binding (inferred); transferase activity (inferred); ubiquitin protein ligase activity (inferred); INVOLVED IN protein ubiquitination (inferred); FOUND IN cytoplasmic vesicle (inferred); cytoplasmic vesicle membrane (inferred); endomembrane system (inferred) ; INTERACTS WITH 3-chloropropane-1,2-diol; acrylamide; bisphenol A | 2 | 78628793 | 78730164 | Rat | 39 | old_gene_name , UniProt | gene, protein-coding, VALIDATED [RefSeq] |
| 2231 | C2 | complement C2 | ENCODES a protein that exhibits serine-type endopeptidase activity (ortholog); INVOLVED IN response to nutrient; activation of membrane attack complex (ortholog); complement activation (ortholog); PARTICIPATES IN coagulation cascade pathway; complement system pathway; Staphylococcus aureus infection pathway; ASSOCIATED WITH Chronic Hepatitis B; age related macular degeneration 14 (ortholog); Alzheimer's disease (ortholog); FOUND IN classical-complement-pathway C3/C5 convertase complex (ortholog); symbiont cell surface (ortholog); INTERACTS WITH 1,3-dinitrobenzene; 17alpha-ethynylestradiol; 17beta-estradiol | 20 | 3944722 | 3975006 | Rat | 188 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1359565 | Mettl6 | methyltransferase 6, tRNA N3-cytidine | ENCODES a protein that exhibits enzyme binding (ortholog); tRNA (cytidine-3-)-methyltransferase activity (ortholog); INVOLVED IN tRNA C3-cytosine methylation (ortholog); tRNA methylation (ortholog); tRNA modification (orthol og); PARTICIPATES IN selenoamino acid metabolic pathway; histidine metabolic pathway; tyrosine metabolic pathway; ASSOCIATED WITH Breast Neoplasms (ortholog); FOUND IN cytoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 1,3-dinitrobenzene; 2,4-dinitrotoluene; bisphenol A | 16 | 6667971 | 6705385 | Rat | 87 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1310065 | Cr2 | complement C3d receptor 2 | ENCODES a protein that exhibits complement binding (ortholog); complement receptor activity (ortholog); DNA binding (ortholog); INVOLVED IN B cell activation (ortholog); B cell differentiation (ortholog); B cell proliferation (ortholog); PARTICIPATES IN B cell receptor signaling pathway; coagulation cascade pathway; complement system pathway; ASSOCIATED WITH Spinal Cord Injuries; common variable immunodeficiency (ortholog); common variable immunodeficiency 2 (ortholog); FOUND IN cell surface; extracellular space; external side of plasma membrane (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; alpha-Zearalanol; bisphenol A | 13 | 109207034 | 109244980 | Rat | 114 | name | gene, protein-coding, VALIDATED [RefSeq] |
| 2399 | Cr1l | complement C3b/C4b receptor 1 like | INVOLVED IN negative regulation of complement activation; cellular response to hypoxia (ortholog); complement activation (ortholog); PARTICIPATES IN coagulation cascade pathway; complement system pathway; FOUND IN basolateral plasma membrane (ortholog); cell surface (ortholog); external side of plas ma membrane (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene; 2-nitrofluorene | 13 | 109138132 | 109189068 | Rat | 100 | name | gene, protein-coding, REVIEWED [RefSeq] |
| 62009 | Zfp36l1 | zinc finger protein 36, C3H type-like 1 | ENCODES a protein that exhibits mRNA 3'-UTR AU-rich region binding; mRNA binding; 14-3-3 protein binding (ortholog); INVOLVED IN mRNA catabolic process; nuclear-transcribed mRNA catabolic process, deadenylation-independent decay; positive regulation of nuclear-transcribed mRNA catabolic process, dea denylation-dependent decay; ASSOCIATED WITH COVID-19 (ortholog); FOUND IN cytosol; cytoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol | 6 | 104663396 | 104669815 | Rat | 311 | old_gene_name , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1308913 | Zfp36l2 | zinc finger protein 36, C3H type-like 2 | ENCODES a protein that exhibits mRNA 3'-UTR AU-rich region binding (ortholog); INVOLVED IN 3'-UTR-mediated mRNA destabilization (ortholog); cellular response to epidermal growth factor stimulus (ortholog); cellular response to fibroblast growth factor stimulus (ortholog); ASSOCIATED WITH Colorectal Neoplasms (ortholog); COVID-19 (ortholog); Oocyte/Zygote/Embryo Maturation Arrest 13 (ortholog); FOUND IN cytoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 17beta-estradiol; 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine | 6 | 16242622 | 16246662 | Rat | 245 | old_gene_name , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 708404 | Rbck1 | RANBP2-type and C3HC4-type zinc finger containing 1 | ENCODES a protein that exhibits double-stranded DNA binding; protein kinase C binding; identical protein binding (ortholog); INVOLVED IN positive regulation of transcription by RNA polymerase II; defense response to bacterium (ortholog); negative regulation of necroptotic process (ortholog); PARTICI PATES IN nuclear factor kappa B signaling pathway; tumor necrosis factor mediated signaling pathway; ASSOCIATED WITH Cardiomegaly (ortholog); genetic disease (ortholog); glycogen storage disease IV (ortholog); FOUND IN LUBAC complex (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; aflatoxin B1; allethrin | 3 | 161249389 | 161266321 | Rat | 160 | old_gene_name , name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1593829 | Zfp36l2-ps1 | zinc finger protein 36, C3H type-like 2, pseudogene 1 | | 7 | 776482 | 779046 | Rat | | old_gene_name , name | gene, pseudo, MODEL [RefSeq] |
| 620429 | Cfi | complement factor I | ENCODES a protein that exhibits hydrolase activity (inferred); metal ion binding (inferred); peptidase activity (inferred); INVOLVED IN cellular response to interleukin-6; complement activation (ortholog); proteolysis (ortholog); PARTICIPATES IN coagulation cascade pathway; complement system pathway ; Staphylococcus aureus infection pathway; ASSOCIATED WITH Hearing Loss, Noise-Induced; age related macular degeneration 13 (ortholog); atypical hemolytic-uremic syndrome (ortholog); FOUND IN extracellular space; INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 17beta-estradiol | 2 | 221062206 | 221104790 | Rat | 210 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1359508 | C2h4orf33 | similar to human chromosome 4 open reading frame 33 | INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 4,4'-diaminodiphenylmethane | 2 | 126692176 | 126769183 | Rat | 50 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 41400612 | C8h3orf86 | similar to human chromosome 3 open reading frame 86 | | 8 | 131325442 | 131327978 | Rat | | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 402368338 | C11h3orf85 | similar to human chromosome 3 open reading frame 85 | INTERACTS WITH benzo[a]pyrene (ortholog); fipronil (ortholog); hexadecanoic acid (ortholog) | 11 | 65871798 | 65883497 | Rat | 5 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1359320 | C11h3orf38 | similar to human chromosome 3 open reading frame 38 | INVOLVED IN positive regulation of apoptotic process (ortholog); FOUND IN nucleus (ortholog); INTERACTS WITH bisphenol A; 3-isobutyl-1-methyl-7H-xanthine (ortholog); 4,4'-sulfonyldiphenol (ortholog) | 11 | 15930504 | 15935152 | Rat | 31 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1562339 | C11h3orf70 | similar to human chromosome 3 open reading frame 70 | INVOLVED IN nervous system development (inferred); ASSOCIATED WITH Experimental Liver Cirrhosis; INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 4,4'-diaminodiphenylmethane | 11 | 92850327 | 92900608 | Rat | 54 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1559800 | Hmces | 5-hydroxymethylcytosine binding, ES cell specific | ENCODES a protein that exhibits DNA-(abasic site) binding (ortholog); DNA-(apurinic or apyrimidinic site) endonuclease activity (ortholog); protein-DNA covalent cross-linking activity (ortholog); INVOLVED IN DNA damage response (ortholog); double-strand break repair via alternative nonhomologous end joining (ortholog); interstrand cross-link repair (ortholog); FOUND IN replication fork (ortholog); INTERACTS WITH 3-chloropropane-1,2-diol; acetamide; bisphenol A | 4 | 121950129 | 121972937 | Rat | 114 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1565219 | Cphx1 | cytoplasmic polyadenylated homeobox 1 | ENCODES a protein that exhibits DNA binding (inferred); FOUND IN nucleus (inferred); INTERACTS WITH 1-chloro-2,4-dinitrobenzene (ortholog); 4-hydroxyphenyl retinamide (ortholog); all-trans-retinoic acid (ortholog) | 16 | 1540653 | 1544288 | Rat | 18 | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 1562289 | Entr1l3 | endosome associated trafficking regulator 1 like 3 | | X | 8964296 | 8966437 | Rat | | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 1359273 | Cldnd1 | claudin domain containing 1 | FOUND IN apical plasma membrane (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 3,3',4,4',5-pentachlorobiphenyl | 11 | 55352321 | 55358779 | Rat | 71 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1359380 | Timmdc1 | translocase of inner mitochondrial membrane domain containing 1 | INVOLVED IN mitochondrial respiratory chain complex I assembly (inferred); ASSOCIATED WITH Leigh disease (ortholog); nuclear type mitochondrial complex I deficiency 1 (ortholog); nuclear type mitochondrial complex I deficiency 31 (ortholog); FOUND IN mitochondrion (ortholog); nucleoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil | 11 | 75734554 | 75759026 | Rat | 68 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1584130 | Vom1r-ps70 | vomeronasal 1 receptor pseudogene 70 | | 4 | 87673191 | 87674101 | Rat | | old_gene_name | gene, pseudo, INFERRED [RefSeq] |
| 6486936 | C1h3orf38 | similar to human chromosome 3 open reading frame 38 | | 1 | 10504204 | 10505215 | Rat | | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 1560289 | C4h3orf20 | similar to human chromosome 3 open reading frame 20 | FOUND IN cytoplasm (ortholog); INTERACTS WITH aflatoxin B1; bisphenol A; endosulfan | 4 | 125976326 | 126027796 | Rat | 27 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1587811 | C4h3orf22 | similar to human chromosome 3 open reading frame 22 | FOUND IN cytoplasm (ortholog); INTERACTS WITH bisphenol A; (+)-catechin (ortholog); aflatoxin B1 (ortholog) | 4 | 124374885 | 124379380 | Rat | 15 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1589651 | C8h3orf62 | similar to human chromosome 3 open reading frame 62 | ENCODES a protein that exhibits cysteine-type deubiquitinase activity (inferred); cysteine-type peptidase activity (inferred); hydrolase activity (inferred); INVOLVED IN spermatogenesis (ortholog); FOUND IN cytoplasm (inferred); nucleus (inferred); INTERACTS WITH (-)-demecolcine (ortholog); 2-hydrox ypropanoic acid (ortholog); 2-palmitoylglycerol (ortholog) | 8 | 117958583 | 117963137 | Rat | 40 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1305225 | Ccdc174 | coiled-coil domain containing 174 | ASSOCIATED WITH Infantile Hypotonia with Psychomotor Retardation (ortholog); FOUND IN nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 4 | 125949203 | 125976179 | Rat | 55 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1306063 | Cep15 | centrosomal protein 15 | INTERACTS WITH (+)-schisandrin B; 3,3',5-triiodo-L-thyronine; acrylamide | 15 | 15247627 | 15265560 | Rat | 50 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1596842 | Cimip7 | ciliary microtubule inner protein 7 | INTERACTS WITH bisphenol A; Aflatoxin B2 alpha (ortholog); benzo[a]pyrene (ortholog) | 8 | 118002336 | 118019337 | Rat | 3 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1309437 | Cmss1 | cms1 ribosomal small subunit homolog | INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A | 11 | 56403620 | 56701751 | Rat | 84 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2324134 | Cxh3orf38 | similar to human chromosome 3 open reading frame 38 | | X | 23936701 | 23938032 | Rat | | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 1306995 | Tex55 | testis expressed 55 | FOUND IN nucleus (ortholog); sperm flagellum (ortholog); INTERACTS WITH bisphenol A; aflatoxin B1 (ortholog); arsane (ortholog) | 11 | 75432861 | 75449144 | Rat | 13 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 7634115 | C15h3orf49 | similar to human chromosome 3 open reading frame 49 | INTERACTS WITH aflatoxin B1 (ortholog); benzo[a]pyrene (ortholog) | 15 | 13707680 | 13726283 | Rat | 2 | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 1359308 | Marchf3 | membrane associated ring-CH-type finger 3 | ENCODES a protein that exhibits metal ion binding (inferred); transferase activity (inferred); ubiquitin protein ligase activity (inferred); INVOLVED IN endocytosis (inferred); protein ubiquitination (inferred); FOUND IN endosome (ortholog); lysosome (ortholog); INTERACTS WITH (+)-schisandrin B; 1,3 -dinitrobenzene; 2,3,7,8-tetrachlorodibenzodioxine | 18 | 52435292 | 52587321 | Rat | 98 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1305617 | Marchf5 | membrane associated ring-CH-type finger 5 | ENCODES a protein that exhibits GTPase binding (ortholog); ubiquitin protein ligase activity (ortholog); INVOLVED IN negative regulation of cytoplasmic pattern recognition receptor signaling pathway (ortholog); positive regulation of cGAS/STING signaling pathway (ortholog); positive regulation of mi tochondrial fission (ortholog); FOUND IN endoplasmic reticulum (ortholog); endoplasmic reticulum membrane (ortholog); mitochondrial outer membrane (ortholog); INTERACTS WITH 2,4-dinitrotoluene; 2,6-dinitrotoluene; bisphenol A | 1 | 244343674 | 244365160 | Rat | 112 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1565757 | Marchf6 | membrane associated ring-CH-type finger 6 | ENCODES a protein that exhibits enzyme binding (ortholog); ubiquitin conjugating enzyme binding (ortholog); ubiquitin protein ligase activity (ortholog); INVOLVED IN negative regulation of cholesterol biosynthetic process (ortholog); proteasomal protein catabolic process (ortholog); proteasome-media ted ubiquitin-dependent protein catabolic process (ortholog); PARTICIPATES IN Endoplasmic Reticulum-associated degradation pathway; ASSOCIATED WITH familial adult myoclonic epilepsy 3 (ortholog); FOUND IN endoplasmic reticulum (ortholog); endoplasmic reticulum membrane (ortholog); membrane (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 2 | 84166570 | 84243817 | Rat | 109 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1590688 | Marchf9 | membrane associated ring-CH-type finger 9 | ENCODES a protein that exhibits metal ion binding (inferred); transferase activity (inferred); ubiquitin protein ligase activity (inferred); INVOLVED IN protein ubiquitination (inferred); ASSOCIATED WITH familial melanoma (ortholog); FOUND IN Golgi stack (ortholog); trans-Golgi network (ortholog); I NTERACTS WITH bisphenol A; toluene; 1,2-dimethylhydrazine (ortholog) | 7 | 64764346 | 64767824 | Rat | 50 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2318708 | C2h3orf80 | similar to human chromosome 3 open reading frame 80 | INTERACTS WITH aflatoxin B1; 17beta-estradiol (ortholog); all-trans-retinoic acid (ortholog) | 2 | 155435287 | 155438099 | Rat | 18 | old_gene_name | gene, protein-coding, INFERRED [RefSeq] |
| 1303128 | Rnf113a2 | ring finger protein 113A2 | ENCODES a protein that exhibits metal ion binding (inferred); zinc ion binding (inferred); INTERACTS WITH 2,4-dinitrotoluene; 2,6-dinitrotoluene; 6-propyl-2-thiouracil | 6 | 109794794 | 109796075 | Rat | 27 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 620428 | Cfh | complement factor H | ENCODES a protein that exhibits complement component C3b binding (ortholog); heparan sulfate proteoglycan binding (ortholog); heparin binding (ortholog); INVOLVED IN cellular response to hydrogen peroxide; cellular response to lipopolysaccharide; cellular response to type II interferon; PARTICIPATES IN coagulation cascade pathway; complement system pathway; Staphylococcus aureus infection pathway; ASSOCIATED WITH amphetamine abuse; atypical hemolytic-uremic syndrome; Hemorrhagic Shock; FOUND IN extracellular space; axon (ortholog); cell surface (ortholog); INTERACTS WITH (+)-schisandrin B; 17alpha-ethynylestradiol; 17beta-estradiol | 13 | 54063079 | 54164523 | Rat | 366 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1564614 | Cfhr4 | complement factor H-related 4 | ENCODES a protein that exhibits complement component C3b binding (ortholog); heparin binding (ortholog); INVOLVED IN blood coagulation (inferred); ASSOCIATED WITH atypical hemolytic-uremic syndrome (ortholog); kidney disease (ortholog); FOUND IN extracellular space (ortholog); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; acetamide | 13 | 53973301 | 54042179 | Rat | 52 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 620942 | Dnaja1 | DnaJ heat shock protein family (Hsp40) member A1 | ENCODES a protein that exhibits ATPase activator activity; C3HC4-type RING finger domain binding (ortholog); G protein-coupled receptor binding (ortholog); INVOLVED IN androgen receptor signaling pathway (ortholog); flagella ted sperm motility (ortholog); negative regulation of apoptotic process (ortholog); PARTICIPATES IN Endoplasmic Reticulum-associated degradation pathway; ASSOCIATED WITH galactosemia (ortholog); mouth disease (ortholog); FOUND IN cytosol (ortholog); membrane (ortholog); microtubule cytoskeleton (ortholog); INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene | 5 | 60638404 | 60649315 | Rat | 279 | description | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1579886 | F10m2Mcwi | coagulation factor X; mutation 2, Medical College of Wisconsin | mutation generated by ENU (N-ethyl-N-nitrourea); C388Stop mutation is generated from the codon change TGC/TGA | | | | Rat | | description | gene, allele |
| 3322 | Phb1 | prohibitin 1 | ENCODES a protein that exhibits complement component C3a binding (ortholog); complement component C3b binding (ortholog); enzyme binding (ortholog); INVOLVED IN animal organ regeneration; negative regulation of apoptotic process; negative regulation of cell population proliferation; ASSOCIATED WITH Brain Injuries; Experimental Mammary Neoplasms; urinary bladder cancer; FOUND IN extrinsic component of presynaptic active zone membrane; GABA-ergic synapse; glutamatergic synapse; INTERACTS WITH (R)-adrenaline; 17alpha-ethynylestradiol; 17beta-hydroxy-5alpha-androstan-3-one | 10 | 81102043 | 81114815 | Rat | 333 | description | gene, protein-coding, VALIDATED [RefSeq] |
| 1310576 | Mex3d | mex-3 RNA binding family member D | ENCODES a protein that exhibits mRNA 3'-UTR AU-rich region binding (ortholog); FOUND IN nucleus (ortholog); perinuclear region of cytoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acrylamide | 7 | 9976253 | 9983383 | Rat | 68 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1593792 | Polr3g | RNA polymerase III subunit G | ENCODES a protein that exhibits chromatin binding (ortholog); INVOLVED IN cell population proliferation (ortholog); positive regulation of innate immune response (ortholog); positive regulation of interferon-beta production (ortholog); PARTICIPATES IN RNA polymerase III transcription pathway; purine metabolic pathway; pyrimidine metabolic pathway; ASSOCIATED WITH autistic disorder (ortholog); Hereditary Neoplastic Syndromes (ortholog); FOUND IN nuclear body (ortholog); nucleoplasm (ortholog); nucleus (ortholog); INTERACTS WITH 3-chloropropane-1,2-diol; 4,4'-diaminodiphenylmethane; 6-propyl-2-thiouracil | 2 | 13680893 | 13721802 | Rat | 133 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 1590509 | Polr3g-ps2 | RNA polymerase III subunit G, pseudogene 2 | | 1 | 68212676 | 68213436 | Rat | | old_gene_name | gene, pseudo, MODEL [RefSeq] |