D15Got80 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: D15Got80

Symbol:

D15Got80

Previously known as:

oxsts1183; OT47.12;

RGD ID:

60120

Expected Size:

140 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	15	77,185,243 - 77,185,383 (+)	MAPPER	mRatBN7.2
Rnor_6.0	15	84,871,469 - 84,871,608	NCBI	Rnor6.0
Rnor_5.0	15	88,639,787 - 88,639,926	UniSTS	Rnor5.0
RGSC_v3.4	15	84,248,564 - 84,248,704	RGD	RGSC3.4
RGSC_v3.4	15	84,248,565 - 84,248,704	UniSTS	RGSC3.4
RGSC_v3.1	15	84,264,345 - 84,264,484	RGD
Celera	15	76,422,045 - 76,422,188	UniSTS
RH 3.4 Map	15	517.4	RGD
RH 3.4 Map	15	517.4	UniSTS

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	ATCTCTTATACACACACAATCAT
Reverse Primer	AAAAGATTTGCTTCGGAGGATA


GenBank Nucleotide	AU026340	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1549844	Bss7	Bone structure and strength QTL 7	6.4		femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	15	75788062	101769107	Rat
2300326	Plaw1	Placental weight QTL 1	15	0.005	placenta mass (VT:0004257)	placenta wet weight (CMO:0002088)	15	68327165	100062518	Rat
70155	Gcs1	Gastric cancer susceptibility QTL1	3.8		stomach morphology trait (VT:0000470)	stomach tumor susceptibility score (CMO:0002043)	15	76306099	101769107	Rat
1582227	Gluco30	Glucose level QTL 30	3.6	0.0003	blood glucose amount (VT:0000188)	absolute change in blood glucose level area under curve (CMO:0002034)	15	28030665	82262678	Rat
1582228	Epfw3	Epididymal fat weight QTL 3	4.1	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat
1578646	Bmd18	Bone mineral density QTL 18	5.2		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	15	22806240	98288169	Rat
1578647	Bmd17	Bone mineral density QTL 17	4		femur mineral mass (VT:0010011)	total volumetric bone mineral density (CMO:0001728)	15	22806240	98288169	Rat
631516	Gluco31	Glucose level QTL 31	7		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	15	55596089	95018120	Rat
1331724	Bp223	Blood pressure QTL 223	3.53715		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	73690518	95018228	Rat
2317055	Aia10	Adjuvant induced arthritis QTL 10	3.41		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	15	75788062	101769107	Rat
1582214	Stl21	Serum triglyceride level QTL 21	3.1	0.022	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	15	28030665	82262678	Rat
731177	Uae26	Urinary albumin excretion QTL 26	2.4	0.025	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	15	67588667	101769107	Rat
1300144	Rf23	Renal function QTL 23	3.61		renal blood flow trait (VT:2000006)	absolute change in renal vascular resistance (CMO:0001900)	15	40631268	98288169	Rat
1576315	Schws6	Schwannoma susceptibility QTL 6		0.0069	nervous system integrity trait (VT:0010566)	post-insult time of death (CMO:0002005)	15	53806152	98806152	Rat
61477	Aia4	Adjuvant induced arthritis QTL 4	3		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	15	55596089	91365858	Rat
70182	BpQTLcluster12	Blood pressure QTL cluster 12	3.53		arterial blood pressure trait (VT:2000000)	absolute change in mean arterial blood pressure (CMO:0000533)	15	73690657	95018120	Rat
152025253	Hrtrt24	Heart rate QTL 24	3.82		heart pumping trait (VT:2000009)		15	27885774	86257085	Rat
1581555	Eae19	Experimental allergic encephalomyelitis QTL 19	4.7		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	15	76306099	90088744	Rat
631655	Bp126	Blood pressure QTL 126	4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	15	58156477	101769107	Rat
61424	Scl1	Serum cholesterol level QTL 1	7.7	0.001	blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	15	16725528	80672115	Rat
1598828	Glom14	Glomerulus QTL 14	2.5		kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	15	34054139	79054139	Rat
1641889	Colcr6	Colorectal carcinoma resistance QTL 6	2.9	0.0126	intestine integrity trait (VT:0010554)	benign colorectal tumor surface area measurement (CMO:0001799)	15	73690518	99794247	Rat
1582242	Gluco28	Glucose level QTL 28	3.3	0.0008	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	15	28030665	82262678	Rat
1578660	Bss19	Bone structure and strength QTL 19	4.3		femur morphology trait (VT:0000559)	bone trabecular cross-sectional area (CMO:0002311)	15	22806240	98288169	Rat
1582244	Bw79	Body weight QTL 79	4	0.0002	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	15	28030665	82262678	Rat

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: D15Got80