MARC_49992-49993:1124119588:2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: MARC_49992-49993:1124119588:2

Symbol: MARC_49992-49993:1124119588:2
Previously known as:
RGD ID: 5506336
Expected Size: 359 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8631,141,236 - 31,141,595 (+)Marker Load Pipeline
mRatBN7.2625,421,284 - 25,421,642 (+)MAPPERmRatBN7.2
Rnor_6.0626,786,568 - 26,786,925NCBIRnor6.0
Rnor_5.0636,602,183 - 36,602,540UniSTSRnor5.0
RGSC_v3.4625,404,254 - 25,404,611UniSTSRGSC3.4
Celera624,912,009 - 24,912,366UniSTS
Is Marker For: Genes:   Preb  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGAATCGGGCACCTTCCT
Reverse Primer CCACAGCCACAGAGAACAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
61929Prebprolactin regulatory element binding63113875731142544Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6197587946975879Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)62009763565097635Rat
8552910Pigfal5Plasma insulin-like growth factor 1 level QTL 54.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)62265388967653889Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)62009763565097635Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6323998948239989Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6197587946975879Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6197587946975879Rat
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6144788383Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6197587946975879Rat
2292616Ept15Estrogen-induced pituitary tumorigenesis QTL 154.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6144788383Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6197587946975879Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62661831486868070Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)620859430113082285Rat
2301964Bp323Blood pressure QTL 3234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6186868070Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6323998948239989Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6323998948239989Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62661831486868070Rat
1300128Rf16Renal function QTL 163.89renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6140163351Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)63093763275937632Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)61459947363457687Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)61608937261967788Rat
1358190Ept1Estrogen-induced pituitary tumorigenesis QTL 14.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6144788383Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6323998948239989Rat
1359023Bp272Blood pressure QTL 2722.5arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)62228825732981219Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)62228825767288257Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 58842 UniSTS