AU049691 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: AU049691

Symbol:

AU049691

Previously known as:

RGD ID:

5090337

Expected Size:

185 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	1	205,846,955 - 205,847,140 (+)	MAPPER	mRatBN7.2
Rnor_6.0	1	225,149,637 - 225,149,821	NCBI	Rnor6.0
Rnor_5.0	1	232,087,257 - 232,087,441	UniSTS	Rnor5.0
RGSC_v3.4	1	211,627,200 - 211,627,384	UniSTS	RGSC3.4
Celera	1	203,359,753 - 203,359,937	UniSTS
Cytogenetic Map	1	q43	UniSTS

Is Marker For:

Genes: Mta2 Tut1

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CCTCCAGGCTCAGCTGTTT
Reverse Primer	ATTTCCCCTCAAAGATACCCC


GenBank Nucleotide	AU049691	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1578778	Pur4	Proteinuria QTL 4	3.3	0.003	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	1	150700247	252085048	Rat
1354646	Kidm18	Kidney mass QTL 18	5.7		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	151162512	256448636	Rat
1357335	Bw39	Body weight QTL 39	3.3		body mass (VT:0001259)	body weight (CMO:0000012)	1	197814409	242814409	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
2302375	Bw83	Body weight QTL 83	4.87	0.0002	body mass (VT:0001259)	body weight (CMO:0000012)	1	197697768	242697768	Rat
1354652	Kidm20	Kidney mass QTL 20	4.3		kidney mass (VT:0002707)	calculated kidney weight (CMO:0000160)	1	177227632	256448636	Rat
2293674	Bss39	Bone structure and strength QTL 39	7.1	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	1	201554356	246554356	Rat
2302378	Insul11	Insulin level QTL 11	3.25		blood insulin amount (VT:0001560)	serum insulin level (CMO:0000358)	1	144267353	251128347	Rat
1354653	Despr9	Despair related QTL 9		0.00019	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	1	167909849	212909849	Rat
2293673	Bss27	Bone structure and strength QTL 27	18.63	0.0001	femur morphology trait (VT:0000559)	femur midshaft cortical cross-sectional area (CMO:0001663)	1	171629477	216629477	Rat
2293677	Bss41	Bone structure and strength QTL 41	9.38	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra cross-sectional area (CMO:0001689)	1	171629477	216629477	Rat
1302787	Stl25	Serum triglyceride level QTL 25	2.7	0.0073	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	1	180359209	210702199	Rat
1549830	Bss1	Bone structure and strength QTL 1	4.8		femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	172609619	217609619	Rat
7794788	Mcs32	Mammary carcinoma susceptibility QTL 32	2.61		mammary gland integrity trait (VT:0010552)	mammary tumor incidence/prevalence measurement (CMO:0000946)	1	115540693	238914717	Rat
70163	Bw20	Body weight QTL 20	5.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	174133260	219133260	Rat
1578763	Kidm29	Kidney mass QTL 29	3.3	0.0001	kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	1	179567751	260522016	Rat
1600395	Niddm69	Non-insulin dependent diabetes mellitus QTL 69	4.14	0.0002	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	195804352	257091168	Rat
1354624	Cm35	Cardiac mass QTL35	5.7		heart left ventricle mass (VT:0007031)	calculated heart weight (CMO:0000073)	1	177227632	256448636	Rat
1600396	Niddm68	Non-insulin dependent diabetes mellitus QTL 68	4.97	0.0003	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
1558658	Bw59	Body weight QTL 59	3.5	0.0003	body mass (VT:0001259)	body weight (CMO:0000012)	1	178784622	223784622	Rat
631838	Niddm36	Non-insulin dependent diabetes mellitus QTL 36		0.01	insulin secretion trait (VT:0003564)	calculated pancreatic islet insulin release measurement (CMO:0001217)	1	184550676	229550676	Rat
1549837	Hcar15	Hepatocarcinoma resistance QTL 15		0.05	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	153136852	260522016	Rat
2293689	Bss47	Bone structure and strength QTL 47	7.25	0.0001	lumbar vertebra size trait (VT:0010518)	lumbar vertebra trabecular cross-sectional area (CMO:0001692)	1	171629477	216629477	Rat
152025235	Bw194	Body weight QTL 194	4.86		body mass (VT:0001259)		1	123556856	242907031	Rat
1600388	Niddm67	Non-insulin dependent diabetes mellitus QTL 67	5.84	0.000004	blood glucose amount (VT:0000188)	blood glucose level area under curve (AUC) (CMO:0000350)	1	195804352	257091168	Rat
2293694	Bss38	Bone structure and strength QTL 38	7.05	0.0001	femur strength trait (VT:0010010)	femur stiffness (CMO:0001674)	1	201554356	246554356	Rat
1598853	Memor3	Memory QTL 3	4.5		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	1	143506580	212458660	Rat
61341	Bp26	Blood pressure QTL 26			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	169537671	214537671	Rat
1578759	Uae30	Urinary albumin excretion QTL 30	3.3	0.003	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	150700247	252085048	Rat
2293693	Bss22	Bone structure and strength QTL 22	33.52	0.0001	femur morphology trait (VT:0000559)	femur cross-sectional area (CMO:0001661)	1	171629477	216629477	Rat
2300161	Bmd43	Bone mineral density QTL 43	8.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	171629477	216629477	Rat
1300145	Rf7	Renal function QTL 7	2.96		urine creatinine amount (VT:0010540)	urine creatinine level (CMO:0000125)	1	185145134	221264292	Rat
8655655	Arrd2	Age-related retinal degeneration QTL 2	7.79		retinal layer morphology trait (VT:0003727)	percentage of study population developing retinopathy during a period of time (CMO:0002453)	1	183970203	243914901	Rat
1358898	Bp255	Blood pressure QTL 255	3.6		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	191019702	246062233	Rat
631214	Bw61	Body weight QTL61	3.4	0.0001	intramuscular adipose amount (VT:0010044)	intramuscular fat area (CMO:0001162)	1	173108781	218108781	Rat
7771612	Cm80	Cardiac mass QTL 80	8.4		heart left ventricle mass (VT:0007031)	heart left ventricle weight (CMO:0000776)	1	149448574	221264292	Rat
731168	Bp154	Blood pressure QTL 154	3.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	94642644	214537671	Rat
2300175	Bmd40	Bone mineral density QTL 40	15.4	0.0001	femur mineral mass (VT:0010011)	bone mineral density (CMO:0001226)	1	201554356	246554356	Rat
2300174	Bmd42	Bone mineral density QTL 42	8.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	bone mineral density (CMO:0001226)	1	171629477	216629477	Rat
737828	Hcas3	Hepatocarcinoma susceptibility QTL 3	4.9		liver integrity trait (VT:0010547)	liver tumorous lesion volume to total liver volume ratio (CMO:0001082)	1	144267353	222987745	Rat
1354661	Bw33	Body weight QTL 33	5.2		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1358886	Bp260	Blood pressure QTL 260	3.67		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	151162766	225824951	Rat
737977	Bp160	Blood pressure QTL 160		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	181133855	226133855	Rat
2293654	Bss30	Bone structure and strength QTL 30	32.65	0.0001	femur strength trait (VT:0010010)	femur midshaft polar moment of inertia (CMO:0001669)	1	171629477	216629477	Rat
2293655	Bss36	Bone structure and strength QTL 36	10.66	0.0001	femur strength trait (VT:0010010)	femur ultimate force (CMO:0001675)	1	201554356	246554356	Rat
1298084	Thym4	Thymus enlargement QTL 4	10.68		thymus mass (VT:0004954)	thymus weight to body weight ratio (CMO:0000612)	1	197814409	242814409	Rat
724531	Uae5	Urinary albumin excretion QTL 5	4		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	1	150700142	252085212	Rat
2300187	Bmd41	Bone mineral density QTL 41	8.9	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	171629477	216629477	Rat
8552891	Epfw5	Epididymal fat weight QTL 5	4.4		epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	1	193113876	238113876	Rat
1354580	Scort1	Serum corticosterone level QTL 1	3.4		blood corticosterone amount (VT:0005345)	blood corticosterone level (CMO:0001172)	1	156677124	256448636	Rat
1358292	Cm37	Cardiac mass QTL 37	6.2	8e-07	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	1	196248093	241248093	Rat
61376	Bp42	Blood pressure QTL 42	23.4		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	197814409	242814409	Rat
634313	Niddm43	Non-insulin dependent diabetes mellitus QTL 43			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	199050459	259647894	Rat
634312	Bp143	Blood pressure QTL 143	3	0.0002	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	182623426	219932796	Rat
1358294	Bw37	Body weight QTL 37	5	0.000011	body mass (VT:0001259)	body weight (CMO:0000012)	1	171310381	216310381	Rat
724559	Pancm1	Pancreatic morphology QTL 1	7.1		islet of Langerhans morphology trait (VT:0005215)	pancreatic islet damage composite score (CMO:0001156)	1	181759564	214537555	Rat
2312420	Pur17	Proteinuria QTL 17	7.1	0.0001	urine protein amount (VT:0005160)	urine total protein excretion rate (CMO:0000756)	1	156677124	218753816	Rat
10059600	Bp378	Blood pressure QTL 378	3.08	0.05	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	176869060	221869060	Rat
7421630	Bp362	Blood pressure QTL 362		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	118608292	241799120	Rat
619613	Bp77	Blood pressure QTL 77		0.01	arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	164747424	209747424	Rat
2312564	Glom18	Glomerulus QTL 18	2.4	0.003	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	1	185356336	231689108	Rat
634321	Hc1	Hypercalciuria QTL 1	2.91		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	178810256	240830002	Rat
2292218	Kidm35	Kidney mass QTL 35			kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	199368955	224569684	Rat
724562	Rends1	Renal damage susceptibility QTL 1		0.05	kidney glomerulus integrity trait (VT:0010546)	index of glomerular damage (CMO:0001135)	1	169537671	214537671	Rat
1331790	Bp201	Blood pressure QTL 201	3.127		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	198211513	225126682	Rat
10059587	Bw173	Body weight QTL 173	3.23	0.025	body mass (VT:0001259)	body weight (CMO:0000012)	1	202069611	247069611	Rat
2292222	Bp307	Blood pressure QTL 307	3.06	0.0014	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	213533942	Rat
2292220	Bp306	Blood pressure QTL 306	3.47	0.00087	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	164310393	243914901	Rat
10059590	Kidm44	Kidney mass QTL 44	3.42	0.025	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	191033875	236033875	Rat
1641926	Teswt2	Testicular weight QTL 2	2.82		testis mass (VT:1000644)	both testes wet weight (CMO:0000175)	1	197697768	238755659	Rat
631658	Cm7	Cardiac mass QTL 7	5.32	0.0001	aorta mass (VT:0002845)	aorta weight (CMO:0000076)	1	196248093	241248093	Rat
1600380	Niddm70	Non-insulin dependent diabetes mellitus QTL 70	3.1	0.0008	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	1	176550523	221550523	Rat
1354610	Bw34	Body weight QTL 34	4.1		body mass (VT:0001259)	body weight (CMO:0000012)	1	151162512	256448636	Rat
1582206	Kidm33	Kidney mass QTL 33	6.9		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	1	188377360	224054420	Rat
8655855	Arrd3	Age-related retinal degeneration QTL 3	3.07		lens clarity trait (VT:0001304)	cataract incidence/prevalence measurement (CMO:0001585)	1	183970203	243914901	Rat
634338	Hcar4	Hepatocarcinoma resistance QTL 4	4.6		liver integrity trait (VT:0010547)	liver tumorous lesion number to liver area ratio (CMO:0001210)	1	193422268	214537671	Rat
6903303	Scl34	Serum cholesterol QTL 34	2.5	0.0033	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	180359209	218108781	Rat
1600374	Mcs17	Mammary carcinoma susceptibility QTL 17	3		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	1	197670404	242670404	Rat
1600363	Hc6	Hypercalciuria QTL 6	2.7		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	1	203995416	244113296	Rat
2293083	Iddm25	Insulin dependent diabetes mellitus QTL 25	4.18		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	181829673	224569684	Rat
1354606	Bp246	Blood pressure QTL 246	3.6		arterial blood pressure trait (VT:2000000)	pulse pressure (CMO:0000292)	1	102813953	218753816	Rat
738032	Hcas5	Hepatocarcinoma susceptibility QTL 5	3.12		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	176426412	257976495	Rat
1358191	Ept10	Estrogen-induced pituitary tumorigenesis QTL 10	3.8		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	192825253	243914732	Rat
7394701	Uae46	Urinary albumin excretion QTL 46	3.6	0.0056	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	201554356	246554356	Rat

Database	Acc Id	Source(s)
NCBI Gene	361724	UniSTS
	499314	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: AU049691