BF390203 Marker Search Result - Rat Genome Database

Advanced Search (OLGA)

General

Marker: BF390203

Symbol:

BF390203

Previously known as:

RGD ID:

5082835

Expected Size:

165 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	4,964,519 - 4,964,684 (+)	MAPPER	mRatBN7.2
Rnor_6.0	20	5,474,534 - 5,474,698	NCBI	Rnor6.0
Rnor_5.0	20	7,533,146 - 7,533,310	UniSTS	Rnor5.0
RGSC_v3.4	20	5,116,285 - 5,116,449	UniSTS	RGSC3.4
Celera	20	6,548,632 - 6,548,796	UniSTS
RH 3.4 Map	20	56.24	UniSTS
Cytogenetic Map	20	p12	UniSTS

Is Marker For:

Genes: Tapbp

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines


Forward Primer	CTGTCTTCCTGTTAGGTGGTGC
Reverse Primer	TAAATAGAGTGCGGTGCAGCAG

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
3819	Tapbp	TAP binding protein	20	4956937	4966191	Rat


GenBank Nucleotide	BX883042	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JH619588.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2306850	Pia40	Pristane induced arthritis QTL 40		0.0001	joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	1527959	5304575	Rat
1354642	Despr15	Despair related QTL 15		0.0027	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	20	1	24159021	Rat
4889857	Pur27	Proteinuria QTL 27	12.2	0.001	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	20	4606607	17617956	Rat
9590109	Sffal8	Serum free fatty acids level QTL 8	5.32	0.01	blood free fatty acid amount (VT:0001553)	plasma free fatty acids level (CMO:0000546)	20	1	29191651	Rat
9590275	Scort15	Serum corticosterone level QTL 15	3.48	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	29191651	Rat
7175096	Tcs1	T cell selection QTL 1			T cell selection trait (VT:0004917)	expression	20	4727078	5024580	Rat
6893685	Bw111	Body weight QTL 111	2.7	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	20	1	32578807	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
2317057	Aia27	Adjuvant induced arthritis QTL 27	2.83		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	20	2892597	26381954	Rat
61474	Eae1	Experimental allergic encephalomyelitis QTL 1	3		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis severity score (CMO:0001419)	20	4606607	6691706	Rat
7387283	Uae44	Urinary albumin excretion QTL 44		0.1712	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	20	1	26123605	Rat
7411668	Foco32	Food consumption QTL 32	8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	36600972	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
1600382	Edcs3	Endometrial carcinoma susceptibility QTL3	3.5	0.003	uterus morphology trait (VT:0001120)	percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)	20	1	25159026	Rat
1558640	Prcs2	Prostate cancer susceptibility QTL 2	3.3		prostate integrity trait (VT:0010571)	percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)	20	4606607	17617956	Rat
1331772	Cdexp2	CD45RC expression in CD8 T cells QTL 2	5.7		CD8-positive T cell quantity (VT:0008077)	blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)	20	3621649	10078919	Rat
8694189	Bw153	Body weight QTL 153	3.13	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	20	1	29191651	Rat
1300152	Bp195	Blood pressure QTL 195	3.46		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	20	3621649	9243559	Rat
9589155	Insul32	Insulin level QTL 32	6.38	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	20	1	29191651	Rat
7411650	Foco23	Food consumption QTL 23	20.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	29191651	Rat
2317851	Alcrsp22	Alcohol response QTL 22	3.2	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
61432	Cia1	Collagen induced arthritis QTL 1			joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	20	3621656	14101050	Rat
1641893	Alcrsp7	Alcohol response QTL 7			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
9590252	Scort12	Serum corticosterone level QTL 12	20.46	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	36600972	Rat

Database	Acc Id	Source(s)
NCBI Gene	25217	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Create Name:

Description:

Send us a Message

Marker: BF390203