RH141737 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH141737

Symbol: RH141737
Previously known as: AI058490; 
RGD ID: 5080710
Expected Size: 182 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21598,362,040 - 98,362,222 (+)MAPPERmRatBN7.2
Rnor_6.015106,624,579 - 106,624,760NCBIRnor6.0
Rnor_5.015110,018,755 - 110,018,936UniSTSRnor5.0
RGSC_v3.415106,252,183 - 106,252,364UniSTSRGSC3.4
Celera1597,146,428 - 97,146,609UniSTS
RH 3.4 Map15691.3UniSTS
Cytogenetic Map15q24-q25UniSTS
Is Marker For: Genes:   Farp1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGGATGTACTGCAGTCGTTT
Reverse Primer CCCTTTACAGGCCAATATCCAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305346Farp1FERM, ARH/RhoGEF and pleckstrin domain protein 1159812430498363299Rat

Nucleotide Sequences
RefSeq Transcripts NM_001107287 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
1358354Srcrt5Stress Responsive Cort QTL 53.38blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)159815000199043291Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)157369051899794247Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306183 UniSTS