BF386808 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: BF386808

Symbol: BF386808
Previously known as:
RGD ID: 5058214
Expected Size: 156 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21924,976,249 - 24,976,405 (-)MAPPERmRatBN7.2
Rnor_6.01924,295,714 - 24,295,869NCBIRnor6.0
Rnor_5.01935,274,075 - 35,274,230UniSTSRnor5.0
RGSC_v3.41926,706,397 - 26,706,552UniSTSRGSC3.4
Celera1924,517,070 - 24,517,225UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGCATTTGTTACACAAAGCATGA
Reverse Primer CAAGACCATGGCTGAACTTTGA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473972 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000249 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1549847Bss8Bone structure and strength QTL 84lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)19131963836Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
631681Cm12Cardiac mass QTL 123.330.00053heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)19128982497Rat
9590298Uminl5Urine mineral level QTL 53.590.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)19136824771Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61328Eae8Experimental allergic encephalomyelitis QTL 84nervous system integrity trait (VT:0010566)percentage of study population developing experimental autoimmune encephalomyelitis during a period of time (CMO:0001047)192481604133061905Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
1558656Prcs1Prostate cancer susceptibility QTL 15prostate integrity trait (VT:0010571)percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)191511459834521833Rat
9590090Insglur8Insulin/glucose ratio QTL 810.810.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)19136824771Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191560502346559041Rat
1549835Tcas7Tongue tumor susceptibility QTL 70.001tongue integrity trait (VT:0010553)squamous cell carcinoma of the head and neck tumor number (CMO:0001876)192481797839654489Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
724565Tcas5Tongue tumor susceptibility QTL 510.04tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)19997775339654489Rat
61407Scl12Serum cholesterol level QTL 120.001blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)191392640130303727Rat
8552935Pigfal10Plasma insulin-like growth factor 1 level QTL 105.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)19136824771Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
10054132Srcrt9Stress Responsive Cort QTL 92.870.0017blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19127355345Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19745724942983518Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191082797043544039Rat
631678Cm9Cardiac mass QTL 94.270.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)19128982497Rat
9590250Scort11Serum corticosterone level QTL 1123.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19136824771Rat
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19320477748204777Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)1956937445569374Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19218792746708701Rat


Additional Information