RH130147 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: RH130147

Symbol: RH130147
Previously known as: AA998130; 
RGD ID: 5043650
Expected Size: 151 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21155,093,269 - 55,093,420 (+)MAPPERmRatBN7.2
Rnor_6.01160,066,366 - 60,066,516NCBIRnor6.0
Rnor_6.01157,498,700 - 57,498,850NCBIRnor6.0
Rnor_5.01160,661,468 - 60,661,618UniSTSRnor5.0
RGSC_v3.41156,580,687 - 56,580,837UniSTSRGSC3.4
Celera1154,617,801 - 54,617,951UniSTS
Cytogenetic Map11q21UniSTS
Is Marker For: Genes:   Abhd10  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CTGGCACAGCTAAAGTGTACATA
Reverse Primer TGTGTTTGCACAAGTACACAAAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1308084Abhd10abhydrolase domain containing 10, depalmitoylase115508127355095044Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
70180BpQTLcluster10Blood pressure QTL cluster 103.19arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)113491804179918041Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
4889859Pur28Proteinuria QTL 2819.50.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)114545932375190161Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
10755497Bp388Blood pressure QTL 3882.76arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)111945620576331918Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112295940367959403Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)112952841860324829Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113123913478851519Rat
1300135Rf19Renal function QTL 193.38blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)114094618882566702Rat
2312566Glom20Glomerulus QTL 203.60.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)114428575982566702Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
9589032Epfw10Epididymal fat weight QTL 109.290.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)112328045668280456Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
9590313Scort20Serum corticosterone level QTL 206.510.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)112328045668280456Rat
8694424Bw162Body weight QTL 1623.80.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 303953 UniSTS