D11Got20 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D11Got20

Symbol: D11Got20
Previously known as: oxsts776; OT78.45; 
RGD ID: 44904
Expected Size: 164 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21129,628,897 - 29,629,061 (+)MAPPERmRatBN7.2
Rnor_6.01130,537,388 - 30,537,551NCBIRnor6.0
Rnor_5.01134,156,581 - 34,156,744UniSTSRnor5.0
RGSC_v3.41129,638,730 - 29,638,892RGDRGSC3.4
RGSC_v3.41129,638,729 - 29,638,892UniSTSRGSC3.4
RGSC_v3.11129,638,730 - 29,638,892RGD
Celera1129,298,187 - 29,298,350UniSTS
RH 3.4 Map11163.0UniSTS
RH 3.4 Map11163.0RGD
RH 2.0 Map11483.1RGD
Cytogenetic Map11q11UniSTS
Is Marker For: Genes:   Hunk  




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer GGGGAACATGCAAGTTTCTTT
Reverse Primer TCGATCGTAGTCTCCTGTGTATGT
 
GenBank Nucleotide AU025991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 15 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1300147Bp187Blood pressure QTL 1873.67arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)11169446234Rat
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
1598842Glom10Glomerulus QTL 103.4kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)11135331169Rat
8694376Bw156Body weight QTL 1562.250.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)112328045668280456Rat
10755497Bp388Blood pressure QTL 3882.76arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)111945620576331918Rat
724517Uae18Urinary albumin excretion QTL 183.7urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)111647204744285911Rat
10058952Gmadr6Adrenal mass QTL 62.290.0072adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)112295940367959403Rat
1300130Rf20Renal function QTL 204.44kidney glomerulus integrity trait (VT:0010546)kidney glomerulus diameter (CMO:0001166)112952841860324829Rat
1558659Tescar1Testicular tumor resistance QTL 13.9testis integrity trait (VT:0010572)percentage of study population developing testis tumors during a period of time (CMO:0001261)11104193166113562Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat

1 to 10 of 15 rows


Database
Acc Id
Source(s)
NCBI Gene 288275 UniSTS