D9Got50 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D9Got50

Symbol: D9Got50
Previously known as: oxsts2740; OT76.37; 
RGD ID: 44593
Expected Size: 283 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2939,515,976 - 39,516,259 (+)MAPPERmRatBN7.2
Rnor_6.0943,877,186 - 43,877,468NCBIRnor6.0
Rnor_5.0943,520,806 - 43,521,088UniSTSRnor5.0
RGSC_v3.4936,225,944 - 36,226,226UniSTSRGSC3.4
RGSC_v3.4936,225,943 - 36,226,226RGDRGSC3.4
RGSC_v3.1936,227,358 - 36,227,640RGD
Celera937,271,843 - 37,272,125UniSTS
RH 3.4 Map9379.3UniSTS
RH 3.4 Map9379.3RGD
RH 2.0 Map9395.4RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer TGACCTAAGTCCAACTTCCCA
Reverse Primer GAGAAGCAAGATATCACAAACCG
 
GenBank Nucleotide AU025866 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 30 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)93253550577535505Rat
1300180Bw14Body weight QTL 143.776body mass (VT:0001259)body weight (CMO:0000012)92375402461381613Rat
631680Cm11Cardiac mass QTL 113.10.00089heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)92043051965430519Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92526804479271759Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9125408446254084Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9140594091Rat
7207805Bmd88Bone mineral density QTL 884femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)92375402458157242Rat
631643Bp120Blood pressure QTL 12030.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)92207120067071200Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat

1 to 10 of 30 rows