D8Got46 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D8Got46

Symbol: D8Got46
Previously known as: oxsts2619; OT51.11; 
RGD ID: 44390
Expected Size: 154 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8844,628,766 - 44,628,920 (+)Marker Load Pipeline
mRatBN7.2836,439,917 - 36,440,070 (+)MAPPERmRatBN7.2
Rnor_6.0839,200,513 - 39,200,665NCBIRnor6.0
Rnor_5.0839,203,371 - 39,203,523UniSTSRnor5.0
RGSC_v3.4837,973,671 - 37,973,825RGDRGSC3.4
RGSC_v3.4837,973,673 - 37,973,825UniSTSRGSC3.4
RGSC_v3.1837,982,437 - 37,982,591RGD
Celera838,001,174 - 38,001,326UniSTS
RH 3.4 Map8315.0UniSTS
RH 3.4 Map8315.0RGD
RH 2.0 Map8237.8RGD
Cytogenetic Map8q21UniSTS
Is Marker For: Genes:   Chek1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer TCCTCTGAACCTCAACAGAACC
Reverse Primer ACTTTGGGAGAAGGTTCCTATG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620545Chek1checkpoint kinase 184460941744629867Rat



QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357398Slep3Serum leptin concentration QTL 33.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)81799410550763951Rat
2313057Bss76Bone structure and strength QTL 7630.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)83910625891341052Rat
1298065Scl16Serum cholesterol level QTL 163.8blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)83975280384752803Rat
2317030Wbc5White blood cell count QTL 53.210.005leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)81699464261994642Rat
2313067Bss77Bone structure and strength QTL 773.10.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)83910625891341052Rat
1578769Uae31Urinary albumin excretion QTL 313.30.001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)839106363103375781Rat
2317032Ginf2Gastrointestinal inflammation QTL 23.210.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)81296416557964165Rat
2301416Bp315Blood pressure QTL 3150.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)81595227960952279Rat
11556286Cm81Cardiac mass QTL 810.01heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)83910625884106258Rat
2317036Livw3Liver weight QTL 32.430.01liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)81296416557964165Rat
12880023Bw184Body weight QTL 1840.001body mass (VT:0001259)body weight (CMO:0000012)81038254055382540Rat
1578765Klgr1Kidney lesion grade QTL 13.30.0001kidney morphology trait (VT:0002135)organ lesion measurement (CMO:0000677)839106363103375781Rat
12880028Cm103Cardiac mass QTL 1030.02heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)81038254055382540Rat
2317051Aia18Adjuvant induced arthritis QTL 182.42joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)81699464261994642Rat
61464Niddm11Non-insulin dependent diabetes mellitus QTL 113.10.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)84447792689477926Rat
61337Bp22Blood pressure QTL 225.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83910625851589833Rat
2317048Ginf1Gastrointestinal inflammation QTL 13.520.005cecum mucosa thickness (VT:0010234)enterocolitis severity score (CMO:0002138)81296416557964165Rat
1578755Pur5Proteinuria QTL 53.30.0001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)839106258103375958Rat
12880025Cm102Cardiac mass QTL 1020.044heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)81038254055382540Rat
2313088Bss75Bone structure and strength QTL 753.10.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)83910625891341052Rat
1358896Bp262Blood pressure QTL 2622.89arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)835464071107982864Rat
2302278Gluco36Glucose level QTL 364.2blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)83776085958991895Rat
12880044Am9Aortic mass QTL 90.007aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)81038254055382540Rat
631648Stl5Serum triglyceride level QTL 540.0003blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)83546407171842899Rat
724514Uae15Urinary albumin excretion QTL 152.9urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)83776085961459705Rat
61353Bp35Blood pressure QTL 350.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)83910625884106258Rat
631842Inf1Infertility severity QTL 14.10.001seminal gland mass (VT:0010524)seminal vesicle wet weight (CMO:0001603)83154366176543661Rat
1359033Bp273Blood pressure QTL 273arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83910625884106258Rat
61358Bp39Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)84444783789447837Rat
1358907Cm40Cardiac mass QTL 401.89heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)835464071107982864Rat
1598824Memor4Memory QTL 42.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)81799386262252873Rat
1331744Bp217Blood pressure QTL 2173.398arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)83910625867378345Rat
2313046Bss78Bone structure and strength QTL 783.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)83910625891341052Rat
2316950Scl66Serum cholesterol level QTL 664.1blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)839106363114525825Rat
724540Uae8Urinary albumin excretion QTL 85urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)839106258103375958Rat
1358892Kidm26Kidney mass QTL 263.69kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)835464071107982864Rat
1359021Bp271Blood pressure QTL 2711.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)83412590255607752Rat
2302367Slep5Serum leptin concentration QTL 53.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)81799410550763951Rat
61373Mcs4Mammary carcinoma susceptibility QTL 41.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)84447504389475043Rat
70206Alc20Alcohol consumption QTL 202drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)83910625849610361Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 140583 UniSTS