D1Got91 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got91

Symbol: D1Got91
Previously known as: oxsts157; OT61.41; 
RGD ID: 43260
Expected Size: 101 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2188,190,179 - 88,190,280 (+)MAPPERmRatBN7.2
Rnor_6.0191,796,024 - 91,796,124NCBIRnor6.0
Rnor_5.0192,923,769 - 92,923,869UniSTSRnor5.0
RGSC_v3.4188,056,635 - 88,056,736RGDRGSC3.4
RGSC_v3.4188,056,636 - 88,056,736UniSTSRGSC3.4
RGSC_v3.1188,134,747 - 88,134,847RGD
RH 3.4 Map1867.2UniSTS
RH 3.4 Map1867.2RGD
RH 2.0 Map1556.2RGD
Cytogenetic Map1q21UniSTS
Is Marker For: Genes:   Tdrd12  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AATCAGGTGCCCGTGGACA
Reverse Primer AATCAAATTGAAGACCTAGACAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562792Tdrd12tudor domain containing 1218813327188205729Rat

Nucleotide Sequences
GenBank Nucleotide AU027978 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)181591954219808434Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)185424647100358001Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)182174743118944897Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)180592172125592172Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)143284731118944897Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)183547917128547917Rat
152025249Scl82Serum cholesterol level QTL 824.77blood cholesterol amount (VT:0000180)15034351099980958Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)187580395150700247Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 689639 UniSTS