Symbol:
Grin3b
Name:
glutamate ionotropic receptor NMDA type subunit 3B
RGD ID:
621705
Description:
Enables glycine binding activity; monoatomic cation channel activity; and transmitter-gated monoatomic ion channel activity. Involved in cellular response to glycine; ionotropic glutamate receptor signaling pathway; and monoatomic cation transmembrane transport. Located in postsynaptic membrane and presynaptic membrane. Part of NMDA selective glutamate receptor complex. Is active in hippocampal mossy fiber to CA3 synapse; postsynaptic density membrane; and presynaptic active zone membrane. Orthologous to human GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B); PARTICIPATES IN excitatory synaptic transmission pathway; glutamate signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acetamide.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
GluN3B; glutamate [NMDA] receptor subunit 3B; glutamate receptor ionotropic, NMDA 3B; glutamate receptor, ionotropic, N-methyl-D-aspartate 3B; glutamate receptor, ionotropic, NMDA3B; N-methyl-D-aspartate receptor subtype 3B; NMDAR3B; NR3B
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Grin3b (glutamate receptor, ionotropic, NMDA3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Grin3b (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Grin3b (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Grin3b (glutamate ionotropic receptor NMDA type subunit 3B) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
PIK3C2A (phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha) HGNC
OMA
Alliance orthologs 3
Mus musculus (house mouse):
Grin3b (glutamate receptor, ionotropic, NMDA3B)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
GRIN3B (glutamate ionotropic receptor NMDA type subunit 3B)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
grin3bb (glutamate receptor, ionotropic, N-methyl-D-aspartate 3Bb)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB)
Danio rerio (zebrafish):
grin3ba (glutamate receptor, ionotropic, N-methyl-D-aspartate 3Ba)
Alliance
DIOPT (Ensembl Compara|Hieranoid|OMA|OrthoFinder|PANTHER|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
grin3b
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 10,381,495 - 10,387,817 (-) NCBI GRCr8 mRatBN7.2 7 9,730,861 - 9,737,183 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 9,730,862 - 9,737,183 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 12,613,161 - 12,619,488 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 14,488,483 - 14,494,810 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 12,349,681 - 12,356,006 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 12,764,993 - 12,771,310 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 12,764,993 - 12,771,310 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 12,934,715 - 12,941,032 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 11,243,973 - 11,250,311 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 11,243,973 - 11,250,304 (-) NCBI Celera 7 7,906,482 - 7,912,799 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - KEGG (archival)
Grin3b Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 10,381,495 - 10,387,817 (-) NCBI GRCr8 mRatBN7.2 7 9,730,861 - 9,737,183 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 9,730,862 - 9,737,183 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 12,613,161 - 12,619,488 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 14,488,483 - 14,494,810 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 12,349,681 - 12,356,006 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 12,764,993 - 12,771,310 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 12,764,993 - 12,771,310 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 12,934,715 - 12,941,032 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 11,243,973 - 11,250,311 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 11,243,973 - 11,250,304 (-) NCBI Celera 7 7,906,482 - 7,912,799 (-) NCBI Celera Cytogenetic Map 7 q11 NCBI
GRIN3B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 1,000,419 - 1,009,732 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 1,000,419 - 1,009,732 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 1,000,418 - 1,009,731 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 951,437 - 960,723 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 19 932,775 - 942,061 (+) NCBI Celera Cytogenetic Map 19 p13.3 NCBI HuRef 19 773,711 - 783,359 (+) NCBI HuRef CHM1_1 19 999,547 - 1,008,877 (+) NCBI CHM1_1 T2T-CHM13v2.0 19 963,087 - 972,401 (+) NCBI T2T-CHM13v2.0
Grin3b Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 79,806,227 - 79,813,024 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 79,806,549 - 79,813,024 (+) Ensembl GRCm39 Ensembl GRCm38 10 79,970,397 - 79,977,190 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 79,970,715 - 79,977,190 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 79,433,469 - 79,439,935 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 79,373,853 - 79,380,319 (+) NCBI MGSCv36 mm8 Celera 10 80,985,531 - 80,991,997 (+) NCBI Celera Cytogenetic Map 10 C1 NCBI cM Map 10 39.72 NCBI
Grin3b Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955495 6,859,909 - 6,866,306 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955495 6,859,909 - 6,866,297 (-) NCBI ChiLan1.0 ChiLan1.0
GRIN3B Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 5,330,379 - 5,339,749 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 4,569,789 - 4,579,054 (+) NCBI NHGRI_mPanPan1 PanPan1.1 Ensembl 19 975,872 - 982,757 (+) Ensembl panpan1.1 panPan2
GRIN3B Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 20 57,703,569 - 57,710,119 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 20 57,505,626 - 57,512,392 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 20 58,445,553 - 58,452,550 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 20 58,445,603 - 58,452,334 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 20 57,500,871 - 57,509,457 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 20 57,980,403 - 57,987,181 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 20 58,183,413 - 58,190,220 (-) NCBI UU_Cfam_GSD_1.0
Grin3b
GRIN3B Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 77,401,368 - 77,412,136 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 77,402,191 - 77,411,878 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 77,585,744 - 77,595,456 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
GRIN3B
Grin3b
.
Predicted Target Of
Count of predictions: 67 Count of miRNA genes: 60 Interacting mature miRNAs: 62 Transcripts: ENSRNOT00000017064 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
61410 Bw19 Body weight QTL 19 6.2 0.001 body mass (VT:0001259) body weight (CMO:0000012) 7 1 44782185 Rat 1300176 Hrtrt10 Heart rate QTL 10 3.19 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 7 664270 26029351 Rat 9590102 Sffal5 Serum free fatty acids level QTL 5 8.62 0.001 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 7 5329019 50329019 Rat 1643004 Pain2 Pain QTL 2 1 mechanical nociception trait (VT:0002734) self mutilation severity score (CMO:0002145) 7 9462246 98011544 Rat 631503 Bp102 Blood pressure QTL 102 1.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 7 1 44822433 Rat 634336 Anxrr17 Anxiety related response QTL 17 3.66 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 7 924703 115097879 Rat 10755438 Coatc9 Coat color QTL 9 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 3529280 48529280 Rat 9590142 Scort5 Serum corticosterone level QTL 5 24.4 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 7 1 31962314 Rat 2298547 Neuinf5 Neuroinflammation QTL 5 3.7 nervous system integrity trait (VT:0010566) spinal cord Cd74 protein level (CMO:0002131) 7 9462246 58265113 Rat 10059592 Kidm45 Kidney mass QTL 45 3.95 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 7 7573985 52573985 Rat 2317047 Wbc4 White blood cell count QTL 4 0.01 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 7 1 35342956 Rat 10755440 Coatc10 Coat color QTL 10 0 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 7 7496499 52496499 Rat 2298550 Neuinf6 Neuroinflammation QTL 6 3.3 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 7 1 27829089 Rat 724560 Plsm3 Polydactyly-luxate syndrome (PLS) morphotypes QTL 3 0.0003 tibia length (VT:0004357) tibia length (CMO:0000450) 7 1 34000259 Rat 7411566 Bw136 Body weight QTL 136 10.4 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 7 1 31962314 Rat
RH127486
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 9,712,644 - 9,712,846 (+) MAPPER mRatBN7.2 Rnor_6.0 7 12,763,622 - 12,763,823 NCBI Rnor6.0 Rnor_5.0 7 12,933,344 - 12,933,545 UniSTS Rnor5.0 RGSC_v3.4 7 11,225,323 - 11,225,524 UniSTS RGSC3.4 Celera 7 7,888,321 - 7,888,522 UniSTS RH 3.4 Map 7 25.2 UniSTS Cytogenetic Map 7 q11 UniSTS
RH130604
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 9,730,674 - 9,730,885 (-) MAPPER mRatBN7.2 Rnor_6.0 7 12,771,286 - 12,771,496 NCBI Rnor6.0 Rnor_5.0 7 12,941,008 - 12,941,218 UniSTS Rnor5.0 RGSC_v3.4 7 11,243,787 - 11,243,997 UniSTS RGSC3.4 Celera 7 7,906,296 - 7,906,506 UniSTS RH 3.4 Map 7 49.1 UniSTS Cytogenetic Map 7 q11 UniSTS
RH139166
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 7 9,713,029 - 9,713,169 (+) MAPPER mRatBN7.2 Rnor_6.0 7 12,764,007 - 12,764,146 NCBI Rnor6.0 Rnor_5.0 7 12,933,729 - 12,933,868 UniSTS Rnor5.0 RGSC_v3.4 7 11,225,708 - 11,225,847 UniSTS RGSC3.4 Celera 7 7,888,706 - 7,888,845 UniSTS Cytogenetic Map 7 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
23
74
55
54
23
25
23
6
150
71
54
39
52
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000017064 ⟹ ENSRNOP00000017064
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 9,730,862 - 9,737,183 (-) Ensembl Rnor_6.0 Ensembl 7 12,764,993 - 12,771,309 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000093751
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 7 9,730,862 - 9,737,183 (-) Ensembl Rnor_6.0 Ensembl 7 12,764,993 - 12,771,310 (+) Ensembl
RefSeq Acc Id:
NM_133308 ⟹ NP_579842
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 7 10,381,495 - 10,387,817 (-) NCBI mRatBN7.2 7 9,730,861 - 9,737,183 (-) NCBI Rnor_6.0 7 12,764,993 - 12,771,310 (+) NCBI Rnor_5.0 7 12,934,715 - 12,941,032 (+) NCBI RGSC_v3.4 7 11,243,973 - 11,250,311 (-) RGD Celera 7 7,906,482 - 7,912,799 (-) RGD
Sequence:
GCACGAGGGGACAAGAGCGGGTCTGGCTGGGGTGTCTCCTTCCCTTCGCACAGCACAGTGGTAACTTCTTTCGGGATGGAGAGTGTGCGGACGCTGTGGCTCAGCGTGGCCCTGGCGCTGGCGGTGGG
hide sequence
RefSeq Acc Id:
NP_579842 ⟸ NM_133308
- Peptide Label:
precursor
- UniProtKB:
Q8VHN2 (UniProtKB/Swiss-Prot), F1LPZ6 (UniProtKB/TrEMBL)
- Sequence:
MESVRTLWLSVALALAVGSRVVRGHPQPCRVPTRAGASVRLAALLPRAPAARARVLAALATPAPRLPHNLSLELVAVASPTRDPASLARGLCQVLAPPGVVASIAFPEARPELRLLQFLAAATETPVV
hide sequence
Ensembl Acc Id:
ENSRNOP00000017064 ⟸ ENSRNOT00000017064
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-11
Grin3b
glutamate ionotropic receptor NMDA type subunit 3B
Grin3b
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-01-20
Grin3b
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B
glutamate receptor, ionotropic, NMDA3B
Name updated
1299863 APPROVED
2002-08-07
Grin3b
glutamate receptor, ionotropic, NMDA3B
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
expressed predominantly in motor neurons
632842
