Symbol:
Gspt1
Name:
G1 to S phase transition 1
RGD ID:
2751
Description:
Predicted to enable GTPase activity and translation release factor activity. Predicted to be involved in regulation of translational termination and translational termination. Predicted to act upstream of or within protein methylation. Predicted to be part of translation release factor complex. Predicted to be active in cytosolic ribosome. Orthologous to human GSPT1 (G1 to S phase transition 1); PARTICIPATES IN translation termination pathway; mRNA decay pathway; INTERACTS WITH 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane; 17alpha-ethynylestradiol; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
eukaryotic peptide chain release factor GTP-binding subunit ERF3A; eukaryotic peptide chain release factor GTP-binding subunit ERF3B-like; G1 to phase transition 1; G1 to S phase transition protein 1; G1-to-S phase transition 1; LOC100911685; MGC94063
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 4,867,687 - 4,904,186 (+) NCBI GRCr8 mRatBN7.2 10 4,362,528 - 4,397,215 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 4,362,510 - 4,397,198 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 9,059,243 - 9,093,879 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 8,580,331 - 8,614,971 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 4,218,577 - 4,253,220 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 4,313,100 - 4,347,661 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 4,312,863 - 4,446,200 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 3,179,171 - 3,213,732 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 4,249,196 - 4,283,833 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 3,386,388 - 3,421,025 (+) NCBI Celera Cytogenetic Map 10 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gspt1 Rat (-)-demecolcine increases expression ISO GSPT1 (Homo sapiens) 6480464 Demecolcine results in increased expression of GSPT1 mRNA CTD PMID:23649840 Gspt1 Rat 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane increases expression EXP 6480464 o and p'-DDT results in increased expression of GSPT1 mRNA CTD PMID:24096037 Gspt1 Rat 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane increases expression ISO Gspt1 (Mus musculus) 6480464 o and p'-DDT results in increased expression of GSPT1 mRNA CTD PMID:24096037 Gspt1 Rat 1,2-dimethylhydrazine multiple interactions ISO Gspt1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of GSPT1 mRNA CTD PMID:22206623 Gspt1 Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of GSPT1 mRNA CTD PMID:16174780 and PMID:24096037 Gspt1 Rat 17alpha-ethynylestradiol multiple interactions ISO Gspt1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of GSPT1 mRNA CTD PMID:17942748 Gspt1 Rat 17alpha-ethynylestradiol affects expression ISO Gspt1 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of GSPT1 mRNA CTD PMID:17555576 Gspt1 Rat 17alpha-ethynylestradiol increases expression ISO Gspt1 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of GSPT1 mRNA CTD PMID:16174780 more ... Gspt1 Rat 17beta-estradiol increases expression ISO Gspt1 (Mus musculus) 6480464 Estradiol results in increased expression of GSPT1 mRNA CTD PMID:39298647 Gspt1 Rat 17beta-estradiol increases expression ISO GSPT1 (Homo sapiens) 6480464 Estradiol results in increased expression of GSPT1 mRNA CTD PMID:31614463 Gspt1 Rat 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one increases expression ISO GSPT1 (Homo sapiens) 6480464 Metribolone results in increased expression of GSPT1 protein CTD PMID:17152098 Gspt1 Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Gspt1 (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Gspt1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Gspt1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of GSPT1 mRNA CTD PMID:21570461 Gspt1 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Gspt1 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of GSPT1 mRNA CTD PMID:17942748 Gspt1 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Gspt1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of GSPT1 mRNA CTD PMID:17942748 Gspt1 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of GSPT1 mRNA CTD PMID:21346803 Gspt1 Rat 2-amino-2-deoxy-D-glucopyranose multiple interactions ISO GSPT1 (Homo sapiens) 6480464 Glucosamine analog inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] and Glucosamine inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] CTD PMID:18173918 Gspt1 Rat 2-hydroxypropanoic acid decreases expression ISO GSPT1 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of GSPT1 mRNA CTD PMID:30851411 Gspt1 Rat 2-methylcholine affects expression ISO GSPT1 (Homo sapiens) 6480464 beta-methylcholine affects the expression of GSPT1 mRNA CTD PMID:21179406 Gspt1 Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of GSPT1 mRNA CTD PMID:28522335 Gspt1 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GSPT1 mRNA CTD PMID:28628672 Gspt1 Rat 3H-1,2-dithiole-3-thione increases expression ISO Gspt1 (Mus musculus) 6480464 1 and 2-dithiol-3-thione results in increased expression of GSPT1 mRNA CTD PMID:15375163 Gspt1 Rat 4,4'-sulfonyldiphenol increases expression ISO Gspt1 (Mus musculus) 6480464 bisphenol S results in increased expression of GSPT1 mRNA CTD PMID:39298647 Gspt1 Rat 4,4'-sulfonyldiphenol decreases methylation ISO GSPT1 (Homo sapiens) 6480464 bisphenol S results in decreased methylation of GSPT1 gene CTD PMID:31601247 Gspt1 Rat 5-fluorouracil multiple interactions ISO GSPT1 (Homo sapiens) 6480464 TP53 protein affects the reaction [Fluorouracil results in decreased expression of GSPT1 mRNA] CTD PMID:15016801 Gspt1 Rat actinomycin D multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of GSPT1 protein CTD PMID:38460933 Gspt1 Rat aldehydo-D-glucosamine multiple interactions ISO GSPT1 (Homo sapiens) 6480464 Glucosamine analog inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] and Glucosamine inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] CTD PMID:18173918 Gspt1 Rat all-trans-retinoic acid decreases expression ISO GSPT1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of GSPT1 mRNA CTD PMID:33167477 Gspt1 Rat arsenous acid increases expression ISO GSPT1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of GSPT1 mRNA CTD PMID:22521957 Gspt1 Rat arsenous acid multiple interactions ISO Gspt1 (Mus musculus) 6480464 Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of GSPT1 mRNA] CTD PMID:29095437 Gspt1 Rat arsenous acid increases expression ISO Gspt1 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of GSPT1 mRNA CTD PMID:29095437 Gspt1 Rat benzo[a]pyrene increases expression ISO Gspt1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of GSPT1 mRNA CTD PMID:20504355 and PMID:22228805 Gspt1 Rat benzo[a]pyrene affects methylation ISO GSPT1 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of GSPT1 promoter CTD PMID:27901495 Gspt1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO GSPT1 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 and PMID:20018196 Gspt1 Rat beta-D-glucosamine multiple interactions ISO GSPT1 (Homo sapiens) 6480464 Glucosamine analog inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] and Glucosamine inhibits the reaction [TNF results in increased expression of GSPT1 mRNA] CTD PMID:18173918 Gspt1 Rat bis(2-ethylhexyl) phthalate increases expression ISO Gspt1 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of GSPT1 mRNA CTD PMID:34319233 Gspt1 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of GSPT1 mRNA CTD PMID:25181051 Gspt1 Rat bisphenol A decreases expression ISO GSPT1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of GSPT1 mRNA and bisphenol A results in decreased expression of GSPT1 protein CTD PMID:33670352 and PMID:37567409 Gspt1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of GSPT1 mRNA CTD PMID:34947998 Gspt1 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of GSPT1 gene CTD PMID:28505145 Gspt1 Rat Bisphenol B increases expression ISO GSPT1 (Homo sapiens) 6480464 bisphenol B results in increased expression of GSPT1 protein CTD PMID:34186270 Gspt1 Rat bisphenol F multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GSPT1 mRNA CTD PMID:28628672 Gspt1 Rat bisphenol F increases expression ISO GSPT1 (Homo sapiens) 6480464 bisphenol F results in increased expression of GSPT1 protein CTD PMID:34186270 Gspt1 Rat bisphenol F increases expression ISO Gspt1 (Mus musculus) 6480464 bisphenol F results in increased expression of GSPT1 mRNA CTD PMID:38685157 Gspt1 Rat bortezomib decreases expression ISO GSPT1 (Homo sapiens) 6480464 Bortezomib results in decreased expression of GSPT1 mRNA CTD PMID:20977926 Gspt1 Rat buspirone decreases expression EXP 6480464 Buspirone results in decreased expression of GSPT1 mRNA CTD PMID:24136188 Gspt1 Rat cadmium atom decreases expression ISO GSPT1 (Homo sapiens) 6480464 Cadmium results in decreased expression of GSPT1 mRNA CTD PMID:23369406 Gspt1 Rat carbon nanotube decreases expression ISO Gspt1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25620056 Gspt1 Rat carbon nanotube increases expression ISO Gspt1 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Gspt1 Rat chloropicrin decreases expression ISO GSPT1 (Homo sapiens) 6480464 chloropicrin results in decreased expression of GSPT1 mRNA CTD PMID:26352163 Gspt1 Rat chromium(6+) affects expression ISO Gspt1 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of GSPT1 mRNA CTD PMID:28472532 Gspt1 Rat cisplatin decreases expression ISO GSPT1 (Homo sapiens) 6480464 Cisplatin results in decreased expression of GSPT1 mRNA CTD PMID:27594783 Gspt1 Rat cobalt dichloride decreases expression ISO GSPT1 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of GSPT1 mRNA CTD PMID:19320972 Gspt1 Rat copper atom multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in decreased expression of GSPT1 mRNA CTD PMID:20971185 Gspt1 Rat copper(0) multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in decreased expression of GSPT1 mRNA CTD PMID:20971185 Gspt1 Rat cyclosporin A increases expression ISO GSPT1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of GSPT1 mRNA CTD PMID:20106945 Gspt1 Rat cyclosporin A decreases expression ISO GSPT1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of GSPT1 mRNA CTD PMID:25562108 Gspt1 Rat cyclosporin A decreases expression ISO Gspt1 (Mus musculus) 6480464 Cyclosporine results in decreased expression of GSPT1 mRNA CTD PMID:19770486 Gspt1 Rat dexamethasone multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GSPT1 mRNA CTD PMID:28628672 Gspt1 Rat diarsenic trioxide increases expression ISO Gspt1 (Mus musculus) 6480464 Arsenic Trioxide results in increased expression of GSPT1 mRNA CTD PMID:29095437 Gspt1 Rat diarsenic trioxide multiple interactions ISO Gspt1 (Mus musculus) 6480464 Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of GSPT1 mRNA] CTD PMID:29095437 Gspt1 Rat diarsenic trioxide increases expression ISO GSPT1 (Homo sapiens) 6480464 Arsenic Trioxide results in increased expression of GSPT1 mRNA CTD PMID:22521957 Gspt1 Rat diethylstilbestrol increases expression ISO Gspt1 (Mus musculus) 6480464 Diethylstilbestrol results in increased expression of GSPT1 mRNA CTD PMID:16636312 Gspt1 Rat dorsomorphin multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NOG protein co-treated with methylmercuric chloride co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gspt1 Rat doxorubicin decreases expression ISO GSPT1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of GSPT1 mRNA CTD PMID:29803840 Gspt1 Rat enzyme inhibitor multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of GSPT1 protein CTD PMID:23301498 Gspt1 Rat ethyl methanesulfonate decreases expression ISO GSPT1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of GSPT1 mRNA CTD PMID:23649840 Gspt1 Rat fenthion decreases expression ISO Gspt1 (Mus musculus) 6480464 Fenthion results in decreased expression of GSPT1 mRNA CTD PMID:34813904 Gspt1 Rat fipronil decreases expression EXP 6480464 fipronil results in decreased expression of GSPT1 mRNA CTD PMID:34044035 Gspt1 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of GSPT1 mRNA CTD PMID:24136188 Gspt1 Rat folic acid multiple interactions ISO Gspt1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of GSPT1 mRNA CTD PMID:22206623 Gspt1 Rat formaldehyde decreases expression ISO GSPT1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of GSPT1 mRNA CTD PMID:20655997 and PMID:23649840 Gspt1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of GSPT1 mRNA CTD PMID:22061828 Gspt1 Rat indometacin multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of GSPT1 mRNA CTD PMID:28628672 Gspt1 Rat ivermectin decreases expression ISO GSPT1 (Homo sapiens) 6480464 Ivermectin results in decreased expression of GSPT1 protein CTD PMID:32959892 Gspt1 Rat metformin multiple interactions ISO Gspt1 (Mus musculus) 6480464 Metformin inhibits the reaction [Arsenic Trioxide results in increased expression of GSPT1 mRNA] CTD PMID:29095437 Gspt1 Rat methidathion decreases expression ISO Gspt1 (Mus musculus) 6480464 methidathion results in decreased expression of GSPT1 mRNA CTD PMID:34813904 Gspt1 Rat methyl methanesulfonate decreases expression ISO GSPT1 (Homo sapiens) 6480464 Methyl Methanesulfonate results in decreased expression of GSPT1 mRNA CTD PMID:23649840 Gspt1 Rat methylmercury chloride increases expression ISO GSPT1 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of GSPT1 mRNA CTD PMID:26272509 and PMID:28001369 Gspt1 Rat methylmercury chloride decreases expression ISO GSPT1 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of GSPT1 mRNA CTD PMID:28001369 Gspt1 Rat methylmercury chloride multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NOG protein co-treated with methylmercuric chloride co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GSPT1 mRNA CTD PMID:27188386 Gspt1 Rat methylparaben decreases expression ISO GSPT1 (Homo sapiens) 6480464 methylparaben results in decreased expression of GSPT1 mRNA CTD PMID:31745603 Gspt1 Rat N-nitrosodiethylamine multiple interactions ISO Gspt1 (Mus musculus) 6480464 [Piperonyl Butoxide co-treated with Diethylnitrosamine] affects the methylation of GSPT1 gene CTD PMID:23968726 Gspt1 Rat nickel atom increases expression ISO GSPT1 (Homo sapiens) 6480464 Nickel results in increased expression of GSPT1 mRNA CTD PMID:25583101 Gspt1 Rat Nutlin-3 multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of GSPT1 protein CTD PMID:38460933 Gspt1 Rat ochratoxin A increases expression EXP 6480464 ochratoxin A results in increased expression of GSPT1 mRNA CTD PMID:22124623 Gspt1 Rat paracetamol decreases expression ISO GSPT1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of GSPT1 mRNA CTD PMID:21420995 Gspt1 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of GSPT1 mRNA CTD PMID:33387578 Gspt1 Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of GSPT1 mRNA CTD PMID:32680482 Gspt1 Rat perfluorooctanoic acid increases expression ISO GSPT1 (Homo sapiens) 6480464 perfluorooctanoic acid results in increased expression of GSPT1 protein CTD PMID:22609092 Gspt1 Rat PhIP increases expression EXP 6480464 2-amino-1-methyl-6-phenylimidazo(4 and 5-b)pyridine results in increased expression of GSPT1 mRNA CTD PMID:15215175 Gspt1 Rat piperonyl butoxide multiple interactions ISO Gspt1 (Mus musculus) 6480464 [Piperonyl Butoxide co-treated with Diethylnitrosamine] affects the methylation of GSPT1 gene CTD PMID:23968726 Gspt1 Rat pirinixic acid increases expression ISO Gspt1 (Mus musculus) 6480464 pirinixic acid results in increased expression of GSPT1 mRNA CTD PMID:23811191 Gspt1 Rat pirinixic acid decreases expression ISO Gspt1 (Mus musculus) 6480464 pirinixic acid results in decreased expression of GSPT1 mRNA CTD PMID:18445702 Gspt1 Rat propiconazole increases expression ISO Gspt1 (Mus musculus) 6480464 propiconazole results in increased expression of GSPT1 mRNA CTD PMID:21278054 Gspt1 Rat rac-lactic acid decreases expression ISO GSPT1 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of GSPT1 mRNA CTD PMID:30851411 Gspt1 Rat resveratrol decreases expression ISO GSPT1 (Homo sapiens) 6480464 resveratrol results in decreased expression of GSPT1 mRNA CTD PMID:12002526 Gspt1 Rat SB 431542 multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NOG protein co-treated with methylmercuric chloride co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gspt1 Rat sodium arsenite multiple interactions ISO GSPT1 (Homo sapiens) 6480464 sodium arsenite promotes the reaction [GSPT1 protein binds to CAPRIN1 protein] CTD PMID:33939924 Gspt1 Rat tamoxifen affects expression ISO Gspt1 (Mus musculus) 6480464 Tamoxifen affects the expression of GSPT1 mRNA CTD PMID:17555576 Gspt1 Rat tert-butyl hydroperoxide increases expression ISO GSPT1 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased expression of GSPT1 mRNA CTD PMID:15336504 Gspt1 Rat titanium dioxide increases methylation ISO Gspt1 (Mus musculus) 6480464 titanium dioxide results in increased methylation of GSPT1 gene CTD PMID:35295148 Gspt1 Rat titanium dioxide decreases methylation ISO Gspt1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of GSPT1 gene CTD PMID:35295148 Gspt1 Rat trichloroethene increases expression ISO Gspt1 (Mus musculus) 6480464 Trichloroethylene results in increased expression of GSPT1 mRNA CTD PMID:19448997 Gspt1 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of GSPT1 mRNA CTD PMID:33387578 Gspt1 Rat trichostatin A increases expression ISO GSPT1 (Homo sapiens) 6480464 trichostatin A results in increased expression of GSPT1 mRNA CTD PMID:24935251 and PMID:26272509 Gspt1 Rat trimellitic anhydride increases expression ISO Gspt1 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of GSPT1 mRNA CTD PMID:19042947 Gspt1 Rat triphenyl phosphate affects expression ISO GSPT1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of GSPT1 mRNA CTD PMID:37042841 Gspt1 Rat troglitazone decreases expression ISO Gspt1 (Mus musculus) 6480464 troglitazone results in decreased expression of GSPT1 mRNA CTD PMID:28973697 Gspt1 Rat uranium atom increases expression ISO GSPT1 (Homo sapiens) 6480464 Uranium results in increased expression of GSPT1 mRNA CTD PMID:15672453 Gspt1 Rat valproic acid affects expression ISO Gspt1 (Mus musculus) 6480464 Valproic Acid affects the expression of GSPT1 mRNA CTD PMID:17963808 Gspt1 Rat valproic acid multiple interactions ISO GSPT1 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GSPT1 mRNA CTD PMID:27188386 Gspt1 Rat valproic acid increases expression ISO GSPT1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of GSPT1 mRNA CTD PMID:23179753 and PMID:26272509 Gspt1 Rat vincristine increases expression ISO GSPT1 (Homo sapiens) 6480464 Vincristine results in increased expression of GSPT1 mRNA CTD PMID:23649840 Gspt1 Rat zearalenone decreases expression ISO Gspt1 (Mus musculus) 6480464 Zearalenone results in decreased expression of GSPT1 protein CTD PMID:36252740
Imported Annotations - KEGG (archival)
(-)-demecolcine (ISO) 1,1,1-Trichloro-2-(o-chlorophenyl)-2-(p-chlorophenyl)ethane (EXP,ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (ISO) 17beta-hydroxy-17-methylestra-4,9,11-trien-3-one (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-dinitrotoluene (EXP) 2-amino-2-deoxy-D-glucopyranose (ISO) 2-hydroxypropanoic acid (ISO) 2-methylcholine (ISO) 3-chloropropane-1,2-diol (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 3H-1,2-dithiole-3-thione (ISO) 4,4'-sulfonyldiphenol (ISO) 5-fluorouracil (ISO) actinomycin D (ISO) aldehydo-D-glucosamine (ISO) all-trans-retinoic acid (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) beta-D-glucosamine (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) Bisphenol B (ISO) bisphenol F (ISO) bortezomib (ISO) buspirone (EXP) cadmium atom (ISO) carbon nanotube (ISO) chloropicrin (ISO) chromium(6+) (ISO) cisplatin (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) cyclosporin A (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) diethylstilbestrol (ISO) dorsomorphin (ISO) doxorubicin (ISO) enzyme inhibitor (ISO) ethyl methanesulfonate (ISO) fenthion (ISO) fipronil (EXP) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) gentamycin (EXP) indometacin (ISO) ivermectin (ISO) metformin (ISO) methidathion (ISO) methyl methanesulfonate (ISO) methylmercury chloride (ISO) methylparaben (ISO) N-nitrosodiethylamine (ISO) nickel atom (ISO) Nutlin-3 (ISO) ochratoxin A (EXP) paracetamol (EXP,ISO) paraquat (EXP) perfluorooctanoic acid (ISO) PhIP (EXP) piperonyl butoxide (ISO) pirinixic acid (ISO) propiconazole (ISO) rac-lactic acid (ISO) resveratrol (ISO) SB 431542 (ISO) sodium arsenite (ISO) tamoxifen (ISO) tert-butyl hydroperoxide (ISO) titanium dioxide (ISO) trichloroethene (EXP,ISO) trichostatin A (ISO) trimellitic anhydride (ISO) triphenyl phosphate (ISO) troglitazone (ISO) uranium atom (ISO) valproic acid (ISO) vincristine (ISO) zearalenone (ISO)
Gspt1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 4,867,687 - 4,904,186 (+) NCBI GRCr8 mRatBN7.2 10 4,362,528 - 4,397,215 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 4,362,510 - 4,397,198 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 9,059,243 - 9,093,879 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 8,580,331 - 8,614,971 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 4,218,577 - 4,253,220 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 4,313,100 - 4,347,661 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 4,312,863 - 4,446,200 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 3,179,171 - 3,213,732 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 4,249,196 - 4,283,833 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 10 3,386,388 - 3,421,025 (+) NCBI Celera Cytogenetic Map 10 q11 NCBI
GSPT1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 16 11,868,128 - 11,916,654 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 16 11,868,128 - 11,916,082 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 16 11,961,985 - 12,010,511 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 16 11,874,040 - 11,917,309 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 16 11,874,039 - 11,917,309 NCBI Celera 16 12,136,295 - 12,184,521 (-) NCBI Celera Cytogenetic Map 16 p13.13 NCBI HuRef 16 11,878,684 - 11,927,176 (-) NCBI HuRef CHM1_1 16 11,962,002 - 12,010,568 (-) NCBI CHM1_1 T2T-CHM13v2.0 16 11,904,164 - 11,952,697 (-) NCBI T2T-CHM13v2.0
Gspt1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 16 11,034,104 - 11,072,189 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 16 11,037,156 - 11,072,189 (-) Ensembl GRCm39 Ensembl GRCm38 16 11,216,240 - 11,254,325 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 16 11,219,292 - 11,254,325 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 16 11,216,333 - 11,254,418 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 16 11,133,977 - 11,167,574 (-) NCBI MGSCv36 mm8 Celera 16 11,847,904 - 11,885,863 (-) NCBI Celera Cytogenetic Map 16 A1 NCBI cM Map 16 6.38 NCBI
Gspt1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955442 6,704,573 - 6,740,207 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955442 6,704,272 - 6,740,207 (+) NCBI ChiLan1.0 ChiLan1.0
GSPT1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 18 12,419,646 - 12,462,643 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 16 16,185,795 - 16,233,237 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 16 10,807,248 - 10,854,698 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 16 12,031,243 - 12,057,794 (-) NCBI panpan1.1 PanPan1.1 panPan2
GSPT1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 6 30,931,937 - 30,971,699 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 6 30,933,398 - 30,967,476 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 6 32,312,804 - 32,352,081 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 6 31,109,408 - 31,149,538 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 6 31,110,044 - 31,149,470 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 6 30,923,766 - 30,963,908 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 6 30,798,059 - 30,838,371 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 6 31,221,314 - 31,261,658 (+) NCBI UU_Cfam_GSD_1.0
Gspt1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 111,783,470 - 111,818,051 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936530 9,628,844 - 9,650,397 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936530 9,628,905 - 9,663,491 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
GSPT1
GSPT1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 5 11,335,211 - 11,382,904 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 5 11,340,187 - 11,382,310 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666068 18,763,074 - 18,811,569 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Gspt1
.
Predicted Target Of
Count of predictions: 36 Count of miRNA genes: 36 Interacting mature miRNAs: 36 Transcripts: ENSRNOT00000003213 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
634329 Pia15 Pristane induced arthritis QTL 15 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 1 24158324 Rat 2293680 Bss40 Bone structure and strength QTL 40 5.66 0.0001 femur strength trait (VT:0010010) femur total energy absorbed before break (CMO:0001677) 10 1 35225947 Rat 7387235 Uae41 Urinary albumin excretion QTL 41 5.26 0.1874 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 10 1 29497586 Rat 10401803 Kidm50 Kidney mass QTL 50 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 10 418344 45418344 Rat 7411611 Foco17 Food consumption QTL 17 18.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 1 42315980 Rat 631554 Bp133 Blood pressure QTL 133 0.005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 743364 63851208 Rat 1549898 Neuinf3 Neuroinflammation QTL 3 26.4 nervous system integrity trait (VT:0010566) MHC Class II RT1A-positive spinal cord ventral horn area to total spinal cord ventral horn area ratio (CMO:0001980) 10 3406320 5387112 Rat 634327 Hc4 Hypercalciuria QTL 4 2.4 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 10 1 38328221 Rat 70223 Bp57 Blood pressure QTL 57 5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 1 80676123 Rat
RH133814
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 4,362,126 - 4,362,333 (+) MAPPER mRatBN7.2 Rnor_6.0 10 4,411,123 - 4,411,329 NCBI Rnor6.0 Rnor_6.0 10 4,312,651 - 4,312,857 NCBI Rnor6.0 Rnor_5.0 10 3,178,722 - 3,178,928 UniSTS Rnor5.0 Rnor_5.0 10 3,277,052 - 3,277,258 UniSTS Rnor5.0 RGSC_v3.4 10 4,248,747 - 4,248,953 UniSTS RGSC3.4 Celera 10 3,385,939 - 3,386,145 UniSTS Cytogenetic Map 10 q11 UniSTS
WI-19180
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 4,396,780 - 4,397,013 (+) MAPPER mRatBN7.2 Rnor_6.0 10 4,445,775 - 4,446,007 NCBI Rnor6.0 Rnor_6.0 10 4,347,227 - 4,347,459 NCBI Rnor6.0 Rnor_5.0 10 3,213,298 - 3,213,530 UniSTS Rnor5.0 Rnor_5.0 10 3,311,704 - 3,311,936 UniSTS Rnor5.0 RGSC_v3.4 10 4,283,399 - 4,283,631 UniSTS RGSC3.4 Celera 10 3,420,591 - 3,420,823 UniSTS Cytogenetic Map 10 q11 UniSTS
RH128035
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 4,396,936 - 4,397,138 (+) MAPPER mRatBN7.2 Rnor_6.0 10 4,445,931 - 4,446,132 NCBI Rnor6.0 Rnor_6.0 10 4,347,383 - 4,347,584 NCBI Rnor6.0 Rnor_5.0 10 3,213,454 - 3,213,655 UniSTS Rnor5.0 Rnor_5.0 10 3,311,860 - 3,312,061 UniSTS Rnor5.0 RGSC_v3.4 10 4,283,555 - 4,283,756 UniSTS RGSC3.4 Celera 10 3,420,747 - 3,420,948 UniSTS Cytogenetic Map 10 q11 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000003213 ⟹ ENSRNOP00000003213
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 4,362,510 - 4,395,221 (+) Ensembl Rnor_6.0 Ensembl 10 4,411,766 - 4,445,769 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000074487 ⟹ ENSRNOP00000067103
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 4,362,548 - 4,397,198 (+) Ensembl Rnor_6.0 Ensembl 10 4,313,100 - 4,347,659 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000091610 ⟹ ENSRNOP00000071846
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 10 4,312,863 - 4,446,200 (+) Ensembl
RefSeq Acc Id:
NM_001003978 ⟹ NP_001003978
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 4,869,549 - 4,904,186 (+) NCBI mRatBN7.2 10 4,362,576 - 4,397,215 (+) NCBI Rnor_6.0 10 4,313,100 - 4,347,661 (+) NCBI Rnor_5.0 10 3,179,171 - 3,213,732 (+) NCBI RGSC_v3.4 10 4,249,196 - 4,283,833 (+) RGD Celera 10 3,386,388 - 3,421,025 (+) RGD
Sequence:
GCCGCTGTCGCCCCGGTCGCGAGTGCTCAGTCTGGACTGTAGCTGCTGCCCAGGACGCCGGCGAGTGAGTCGTTGGTCTCCAGCTCCCCAGTCTTGCCACCTTCCCTGGGTCATTGCGGCCTGCTCCT
hide sequence
RefSeq Acc Id:
XM_017596996 ⟹ XP_017452485
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 4,867,687 - 4,904,169 (+) NCBI mRatBN7.2 10 4,362,528 - 4,397,187 (+) NCBI Rnor_6.0 10 4,313,294 - 4,347,644 (+) NCBI
Sequence:
ATGGATCCCAGCAGCGGAGGTGGTGGCGGAGGCGGCGGCGGCGGCGGCGGGAGCAGCAGCAGCA
hide sequence
RefSeq Acc Id:
NP_001003978 ⟸ NM_001003978
- UniProtKB:
Q6AYD5 (UniProtKB/TrEMBL), M0RC00 (UniProtKB/TrEMBL), F7F6J0 (UniProtKB/TrEMBL)
- Sequence:
MDPSSGGGGGGGGGGGGSSSSSSDSAPDCWDQTDMEAPGPGPCGGGSMAAVAEAQRENLSAAFSRQLNVNAKPFVPNVHAAEFVPSFLRGPAQPPLSPAGAAGGDHGAGSSAGGPSEPVESSQEQSLC
hide sequence
RefSeq Acc Id:
XP_017452485 ⟸ XM_017596996
- Peptide Label:
isoform X1
- Sequence:
MDPSSGGGGGGGGGGGGSSSSSSDSAPDCWDQTDMEAPGPGPCGGGSMAAVAEAQRENLSAAFSRQLNVNAKPFVPNVHAAEFVPSFLRGPAQPPLSPAGAAGGDHGAGSSAGGPSEPVESSQEQSLC
hide sequence
Ensembl Acc Id:
ENSRNOP00000067103 ⟸ ENSRNOT00000074487
Ensembl Acc Id:
ENSRNOP00000003213 ⟸ ENSRNOT00000003213
Ensembl Acc Id:
ENSRNOP00000071846 ⟸ ENSRNOT00000091610
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2021-03-09
Gspt1
G1 to S phase transition 1
LOC100911685
eukaryotic peptide chain release factor GTP-binding subunit ERF3B-like
Data merged from RGD:6491148
737654 PROVISIONAL
2012-07-05
LOC100911685
eukaryotic peptide chain release factor GTP-binding subunit ERF3B-like
Symbol and Name status set to provisional
70820 PROVISIONAL
2002-06-10
Gspt1
G1-to-S phase transition 1
Symbol and Name status set to approved
70586 APPROVED
