Symbol:
Cpne3
Name:
copine 3
RGD ID:
1310178
Description:
Predicted to enable several functions, including calcium-dependent phospholipid binding activity; calcium-dependent protein binding activity; and receptor tyrosine kinase binding activity. Predicted to be involved in several processes, including ERBB2 signaling pathway; cellular response to calcium ion; and positive regulation of cell migration. Predicted to be located in several cellular components, including focal adhesion; mitochondrion; and nuclear lumen. Predicted to be active in plasma membrane. Orthologous to human CPNE3 (copine 3); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
copine III; copine-3; LOC313087
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
CPNE3 (copine 3) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Cpne3 (copine III) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Cpne3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
CPNE3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
CPNE3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Cpne3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
CPNE3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
CPNE3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Cpne3 (copine 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
ADAMTS16 (ADAM metallopeptidase with thrombospondin type 1 motif 16) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
CPNE3 (copine 3)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Cpne3 (copine III)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
cpne3 (copine III)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
gem-4
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|SonicParanoid)
Caenorhabditis elegans (roundworm):
nra-1
Alliance
DIOPT (InParanoid|OMA|OrthoFinder|OrthoInspector|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
cpne3
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 37,811,566 - 37,860,840 (-) NCBI GRCr8 mRatBN7.2 5 33,014,658 - 33,063,934 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 33,016,307 - 33,063,934 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 35,132,866 - 35,163,717 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 36,725,433 - 36,756,284 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 36,664,563 - 36,695,414 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 33,525,307 - 33,574,610 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 33,528,154 - 33,574,596 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 38,179,711 - 38,229,012 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 34,154,672 - 34,203,959 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 34,157,039 - 34,189,593 (-) NCBI Celera 5 32,108,679 - 32,139,506 (-) NCBI Celera Cytogenetic Map 5 q13 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Cpne3 Rat 1,2-dichloroethane increases expression ISO Cpne3 (Mus musculus) 6480464 ethylene dichloride results in increased expression of CPNE3 mRNA CTD PMID:28960355 Cpne3 Rat 1,2-dimethylhydrazine multiple interactions ISO Cpne3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CPNE3 mRNA CTD PMID:22206623 Cpne3 Rat 1,2-dimethylhydrazine decreases expression ISO Cpne3 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of CPNE3 mRNA CTD PMID:22206623 Cpne3 Rat 1-chloro-2,4-dinitrobenzene decreases expression ISO CPNE3 (Homo sapiens) 6480464 Dinitrochlorobenzene results in decreased expression of CPNE3 mRNA CTD PMID:17374397 Cpne3 Rat 17alpha-ethynylestradiol increases expression ISO Cpne3 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of CPNE3 mRNA CTD PMID:17942748 Cpne3 Rat 17alpha-ethynylestradiol multiple interactions ISO Cpne3 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CPNE3 mRNA CTD PMID:17942748 Cpne3 Rat 17beta-estradiol affects expression EXP 6480464 Estradiol affects the expression of CPNE3 mRNA CTD PMID:32145629 Cpne3 Rat 17beta-estradiol decreases expression ISO Cpne3 (Mus musculus) 6480464 Estradiol results in decreased expression of CPNE3 mRNA CTD PMID:39298647 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Cpne3 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of CPNE3 mRNA CTD PMID:17942748 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CPNE3 mRNA CTD PMID:33387578 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of CPNE3 mRNA CTD PMID:34747641 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of CPNE3 mRNA CTD PMID:32109520 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Cpne3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of CPNE3 mRNA CTD PMID:21570461 Cpne3 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Cpne3 (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of CPNE3 mRNA CTD PMID:19770486 Cpne3 Rat 2,6-dimethoxyphenol multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Cpne3 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of CPNE3 mRNA CTD PMID:21346803 Cpne3 Rat 3-chloropropane-1,2-diol increases expression EXP 6480464 alpha-Chlorohydrin results in increased expression of CPNE3 mRNA CTD PMID:28522335 Cpne3 Rat 4,4'-diaminodiphenylmethane decreases expression ISO Cpne3 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of CPNE3 mRNA CTD PMID:18648102 Cpne3 Rat 4,4'-sulfonyldiphenol decreases expression ISO Cpne3 (Mus musculus) 6480464 bisphenol S results in decreased expression of CPNE3 mRNA CTD PMID:39298647 Cpne3 Rat 4-(ethoxymethylene)-2-phenyloxazol-5-one decreases expression ISO CPNE3 (Homo sapiens) 6480464 Oxazolone results in decreased expression of CPNE3 mRNA CTD PMID:17374397 Cpne3 Rat acrylamide decreases expression EXP 6480464 Acrylamide results in decreased expression of CPNE3 mRNA CTD PMID:28959563 Cpne3 Rat antimycin A decreases expression ISO CPNE3 (Homo sapiens) 6480464 Antimycin A results in decreased expression of CPNE3 mRNA CTD PMID:33512557 Cpne3 Rat aristolochic acid A decreases expression ISO CPNE3 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of CPNE3 mRNA CTD PMID:33212167 Cpne3 Rat arsane affects methylation ISO CPNE3 (Homo sapiens) 6480464 Arsenic affects the methylation of CPNE3 gene CTD PMID:25304211 Cpne3 Rat arsane multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CPNE3 mRNA CTD PMID:39836092 Cpne3 Rat arsenic atom affects methylation ISO CPNE3 (Homo sapiens) 6480464 Arsenic affects the methylation of CPNE3 gene CTD PMID:25304211 Cpne3 Rat arsenic atom multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of CPNE3 mRNA CTD PMID:39836092 Cpne3 Rat benzatropine decreases expression ISO CPNE3 (Homo sapiens) 6480464 Benztropine results in decreased expression of CPNE3 protein CTD PMID:34122009 Cpne3 Rat benzo[a]pyrene decreases methylation ISO CPNE3 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of CPNE3 5' UTR CTD PMID:27901495 Cpne3 Rat benzo[a]pyrene diol epoxide I decreases expression ISO CPNE3 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Cpne3 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of CPNE3 mRNA CTD PMID:25181051 and PMID:33296240 Cpne3 Rat bisphenol A multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of CPNE3 gene CTD PMID:31601247 Cpne3 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CPNE3 mRNA CTD PMID:34947998 Cpne3 Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of CPNE3 mRNA CTD PMID:32145629 Cpne3 Rat bisphenol AF increases expression ISO CPNE3 (Homo sapiens) 6480464 bisphenol AF results in increased expression of CPNE3 protein CTD PMID:34186270 Cpne3 Rat Bisphenol B increases expression ISO CPNE3 (Homo sapiens) 6480464 bisphenol B results in increased expression of CPNE3 protein CTD PMID:34186270 Cpne3 Rat bisphenol F increases expression ISO Cpne3 (Mus musculus) 6480464 bisphenol F results in increased expression of CPNE3 mRNA CTD PMID:38685157 Cpne3 Rat bisphenol F increases expression ISO CPNE3 (Homo sapiens) 6480464 bisphenol F results in increased expression of CPNE3 protein CTD PMID:34186270 Cpne3 Rat cadmium atom increases expression ISO CPNE3 (Homo sapiens) 6480464 Cadmium results in increased expression of CPNE3 mRNA CTD PMID:24376830 Cpne3 Rat cadmium dichloride decreases expression ISO Cpne3 (Mus musculus) 6480464 Cadmium Chloride results in decreased expression of CPNE3 mRNA CTD PMID:24982889 Cpne3 Rat calciol increases expression ISO Cpne3 (Mus musculus) 6480464 Cholecalciferol results in increased expression of CPNE3 mRNA CTD PMID:16508948 Cpne3 Rat chloroprene increases expression EXP 6480464 Chloroprene results in increased expression of CPNE3 mRNA CTD PMID:23125180 Cpne3 Rat crocidolite asbestos decreases expression ISO Cpne3 (Mus musculus) 6480464 Asbestos and Crocidolite results in decreased expression of CPNE3 mRNA CTD PMID:29279043 Cpne3 Rat cyclosporin A decreases expression ISO Cpne3 (Mus musculus) 6480464 Cyclosporine results in decreased expression of CPNE3 mRNA CTD PMID:19770486 Cpne3 Rat cyclosporin A decreases expression ISO CPNE3 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of CPNE3 mRNA CTD PMID:25562108 Cpne3 Rat deguelin decreases expression ISO CPNE3 (Homo sapiens) 6480464 deguelin results in decreased expression of CPNE3 mRNA CTD PMID:33512557 Cpne3 Rat dorsomorphin multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of CPNE3 mRNA CTD PMID:27188386 Cpne3 Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of CPNE3 mRNA CTD PMID:29391264 Cpne3 Rat enzyme inhibitor multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of CPNE3 protein CTD PMID:23301498 Cpne3 Rat ethanol increases expression ISO Cpne3 (Mus musculus) 6480464 Ethanol results in increased expression of CPNE3 mRNA CTD PMID:30319688 Cpne3 Rat flutamide decreases expression EXP 6480464 Flutamide results in decreased expression of CPNE3 mRNA CTD PMID:24136188 Cpne3 Rat folic acid multiple interactions ISO Cpne3 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of CPNE3 mRNA CTD PMID:22206623 Cpne3 Rat formaldehyde decreases expression ISO CPNE3 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of CPNE3 mRNA CTD PMID:23649840 Cpne3 Rat fulvestrant multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of CPNE3 gene CTD PMID:31601247 Cpne3 Rat furfural multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Cpne3 Rat geldanamycin increases expression ISO CPNE3 (Homo sapiens) 6480464 geldanamycin results in increased expression of CPNE3 mRNA CTD PMID:26705709 Cpne3 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of CPNE3 mRNA CTD PMID:33387578 Cpne3 Rat glafenine decreases expression EXP 6480464 Glafenine results in decreased expression of CPNE3 mRNA CTD PMID:24136188 Cpne3 Rat haloperidol decreases expression ISO CPNE3 (Homo sapiens) 6480464 Haloperidol results in decreased expression of CPNE3 protein CTD PMID:34122009 Cpne3 Rat ivermectin decreases expression ISO CPNE3 (Homo sapiens) 6480464 Ivermectin results in decreased expression of CPNE3 protein CTD PMID:32959892 Cpne3 Rat manganese atom multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA CTD PMID:39836092 Cpne3 Rat manganese(0) multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA CTD PMID:39836092 Cpne3 Rat manganese(II) chloride multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA CTD PMID:39836092 Cpne3 Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of CPNE3 mRNA CTD PMID:30467583 Cpne3 Rat methylmercury chloride decreases expression ISO CPNE3 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of CPNE3 mRNA CTD PMID:28001369 Cpne3 Rat nickel sulfate decreases expression ISO CPNE3 (Homo sapiens) 6480464 nickel sulfate results in decreased expression of CPNE3 mRNA CTD PMID:17374397 Cpne3 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of CPNE3 mRNA CTD PMID:33387578 Cpne3 Rat perfluorooctanoic acid increases expression ISO Cpne3 (Mus musculus) 6480464 perfluorooctanoic acid results in increased expression of CPNE3 protein CTD PMID:37422089 Cpne3 Rat SB 431542 multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of CPNE3 mRNA CTD PMID:27188386 Cpne3 Rat sodium arsenate increases expression ISO Cpne3 (Mus musculus) 6480464 sodium arsenate results in increased expression of CPNE3 mRNA CTD PMID:21795629 Cpne3 Rat sodium arsenite multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of CPNE3 mRNA more ... CTD PMID:37734572 and PMID:39836092 Cpne3 Rat sodium arsenite decreases expression ISO CPNE3 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of CPNE3 protein CTD PMID:30528433 Cpne3 Rat sodium chloride multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of and affects the localization of CPNE3 protein more ... CTD PMID:38598786 Cpne3 Rat sunitinib increases expression ISO CPNE3 (Homo sapiens) 6480464 Sunitinib results in increased expression of CPNE3 mRNA CTD PMID:31533062 Cpne3 Rat tebufenpyrad decreases expression ISO CPNE3 (Homo sapiens) 6480464 4-chloro-N-((4-(1 and 1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide results in decreased expression of CPNE3 mRNA CTD PMID:33512557 Cpne3 Rat testosterone enanthate affects expression ISO CPNE3 (Homo sapiens) 6480464 testosterone enanthate affects the expression of CPNE3 mRNA CTD PMID:17440010 Cpne3 Rat tetrachloromethane decreases expression ISO Cpne3 (Mus musculus) 6480464 Carbon Tetrachloride results in decreased expression of CPNE3 mRNA CTD PMID:31919559 Cpne3 Rat thifluzamide decreases expression ISO CPNE3 (Homo sapiens) 6480464 thifluzamide results in decreased expression of CPNE3 mRNA CTD PMID:33512557 Cpne3 Rat thimerosal decreases expression ISO CPNE3 (Homo sapiens) 6480464 Thimerosal results in decreased expression of CPNE3 mRNA CTD PMID:27188386 Cpne3 Rat titanium dioxide increases expression ISO Cpne3 (Mus musculus) 6480464 titanium dioxide results in increased expression of CPNE3 mRNA CTD PMID:29264374 Cpne3 Rat titanium dioxide decreases methylation ISO Cpne3 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of CPNE3 gene and titanium dioxide results in decreased methylation of CPNE3 promoter alternative form CTD PMID:35295148 Cpne3 Rat trichloroethene decreases expression EXP 6480464 Trichloroethylene results in decreased expression of CPNE3 mRNA CTD PMID:33387578 Cpne3 Rat trichostatin A decreases expression ISO CPNE3 (Homo sapiens) 6480464 trichostatin A results in decreased expression of CPNE3 mRNA CTD PMID:24935251 and PMID:26272509 Cpne3 Rat trichostatin A multiple interactions ISO CPNE3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of CPNE3 mRNA CTD PMID:27188386 Cpne3 Rat triphenyl phosphate affects expression ISO CPNE3 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of CPNE3 mRNA CTD PMID:37042841 Cpne3 Rat triphenyl phosphate increases expression EXP 6480464 triphenyl phosphate results in increased expression of CPNE3 mRNA CTD PMID:30589522 Cpne3 Rat triticonazole increases expression EXP 6480464 triticonazole results in increased expression of CPNE3 mRNA CTD PMID:36084822 Cpne3 Rat valproic acid decreases methylation ISO CPNE3 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of CPNE3 gene CTD PMID:29154799 Cpne3 Rat valproic acid increases expression ISO CPNE3 (Homo sapiens) 6480464 Valproic Acid results in increased expression of CPNE3 mRNA CTD PMID:19101580 Cpne3 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of CPNE3 mRNA CTD PMID:23869203 Cpne3 Rat vincristine decreases expression ISO CPNE3 (Homo sapiens) 6480464 Vincristine results in decreased expression of CPNE3 mRNA CTD PMID:23649840 Cpne3 Rat vorinostat decreases expression ISO CPNE3 (Homo sapiens) 6480464 vorinostat results in decreased expression of CPNE3 mRNA CTD PMID:27188386 Cpne3 Rat zoledronic acid increases expression ISO CPNE3 (Homo sapiens) 6480464 zoledronic acid results in increased expression of CPNE3 mRNA CTD PMID:20977926
1,2-dichloroethane (ISO) 1,2-dimethylhydrazine (ISO) 1-chloro-2,4-dinitrobenzene (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 2,6-dinitrotoluene (EXP) 3-chloropropane-1,2-diol (EXP) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (ISO) 4-(ethoxymethylene)-2-phenyloxazol-5-one (ISO) acrylamide (EXP) antimycin A (ISO) aristolochic acid A (ISO) arsane (ISO) arsenic atom (ISO) benzatropine (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calciol (ISO) chloroprene (EXP) crocidolite asbestos (ISO) cyclosporin A (ISO) deguelin (ISO) dorsomorphin (ISO) endosulfan (EXP) enzyme inhibitor (ISO) ethanol (ISO) flutamide (EXP) folic acid (ISO) formaldehyde (ISO) fulvestrant (ISO) furfural (ISO) geldanamycin (ISO) gentamycin (EXP) glafenine (EXP) haloperidol (ISO) ivermectin (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methapyrilene (EXP) methylmercury chloride (ISO) nickel sulfate (ISO) paracetamol (EXP) perfluorooctanoic acid (ISO) SB 431542 (ISO) sodium arsenate (ISO) sodium arsenite (ISO) sodium chloride (ISO) sunitinib (ISO) tebufenpyrad (ISO) testosterone enanthate (ISO) tetrachloromethane (ISO) thifluzamide (ISO) thimerosal (ISO) titanium dioxide (ISO) trichloroethene (EXP) trichostatin A (ISO) triphenyl phosphate (EXP,ISO) triticonazole (EXP) valproic acid (ISO) vinclozolin (EXP) vincristine (ISO) vorinostat (ISO) zoledronic acid (ISO)
Cellular Component
cell junction (IEA,ISO) cytoplasm (IEA,ISO) cytosol (IEA,ISO) focal adhesion (IEA,ISO) mitochondrion (IEA,ISO) nucleolus (IEA,ISO) nucleoplasm (IEA,ISO) nucleus (IEA,ISO) plasma membrane (IBA,IEA,ISO)
Cpne3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 37,811,566 - 37,860,840 (-) NCBI GRCr8 mRatBN7.2 5 33,014,658 - 33,063,934 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 33,016,307 - 33,063,934 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 35,132,866 - 35,163,717 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 36,725,433 - 36,756,284 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 36,664,563 - 36,695,414 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 33,525,307 - 33,574,610 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 33,528,154 - 33,574,596 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 38,179,711 - 38,229,012 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 34,154,672 - 34,203,959 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 34,157,039 - 34,189,593 (-) NCBI Celera 5 32,108,679 - 32,139,506 (-) NCBI Celera Cytogenetic Map 5 q13 NCBI
CPNE3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 86,514,435 - 86,561,498 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 86,514,435 - 86,561,498 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 87,526,664 - 87,573,726 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 87,595,788 - 87,642,842 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 87,595,787 - 87,642,842 NCBI Celera 8 83,721,201 - 83,768,282 (+) NCBI Celera Cytogenetic Map 8 q21.3 NCBI HuRef 8 82,736,053 - 82,783,152 (+) NCBI HuRef CHM1_1 8 87,568,152 - 87,615,225 (+) NCBI CHM1_1 T2T-CHM13v2.0 8 87,634,662 - 87,681,751 (+) NCBI T2T-CHM13v2.0
Cpne3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 19,519,252 - 19,570,108 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 19,519,254 - 19,570,108 (-) Ensembl GRCm39 Ensembl GRCm38 4 19,519,252 - 19,570,108 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 19,519,254 - 19,570,108 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 19,446,399 - 19,497,251 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 4 19,446,399 - 19,497,251 (-) NCBI MGSCv36 mm8 Celera 4 19,281,183 - 19,332,079 (-) NCBI Celera Cytogenetic Map 4 A3 NCBI cM Map 4 7.53 NCBI
Cpne3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955417 4,115,308 - 4,145,939 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955417 4,115,298 - 4,146,878 (+) NCBI ChiLan1.0 ChiLan1.0
CPNE3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 103,916,914 - 103,963,965 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 79,455,749 - 79,502,801 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 83,209,949 - 83,257,088 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 85,179,146 - 85,225,585 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 85,151,133 - 85,225,585 (+) Ensembl panpan1.1 panPan2
CPNE3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 29 32,682,019 - 32,736,871 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 29 32,695,714 - 32,727,950 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 ROS_Cfam_1.0 29 32,836,903 - 32,892,322 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 29 32,836,919 - 32,885,994 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 29 32,880,698 - 32,935,491 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 29 32,905,282 - 32,960,515 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 29 33,325,872 - 33,381,277 (+) NCBI UU_Cfam_GSD_1.0
Cpne3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 46,642,423 - 46,698,457 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936544 1,104,791 - 1,147,320 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936544 1,094,257 - 1,147,964 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CPNE3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 4 50,276,426 - 50,345,366 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 4 50,276,330 - 50,345,400 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 4 55,192,149 - 55,251,298 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CPNE3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 81,697,014 - 81,744,851 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 81,711,571 - 81,745,019 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666039 59,205,525 - 59,253,357 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Cpne3
.
Predicted Target Of
Count of predictions: 117 Count of miRNA genes: 97 Interacting mature miRNAs: 101 Transcripts: ENSRNOT00000008281 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
2293666 Bmd38 Bone mineral density QTL 38 4.4 femur size trait (VT:1000369) femoral neck cortical cross-sectional area (CMO:0001702) 5 8948228 53948228 Rat 1578776 Stresp18 Stress response QTL 18 2.9 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 5 27955440 72955440 Rat 1576314 Eutr1 Estrogen induced uterine response QTL 1 uterus integrity trait (VT:0010575) pyometritis severity score (CMO:0002009) 5 2138965 166875058 Rat 6903306 Scl35 Serum cholesterol QTL 35 2.6 0.0073 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 28515489 73515489 Rat 70212 Niddm25 Non-insulin dependent diabetes mellitus QTL 25 3.54 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 5 1 131345958 Rat 1358353 Srcrtb2 Stress Responsive Cort Basal QTL 2 3.48 0.003 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 5 18873947 74251464 Rat 1300117 Hrtrt8 Heart rate QTL 8 3.49 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 5 3844018 47869213 Rat 7394712 Emca13 Estrogen-induced mammary cancer QTL 13 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 9823266 99753708 Rat 634305 Mamtr1 Mammary tumor resistance QTL 1 0.0001 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 12789751 113558310 Rat 1331771 Rf35 Renal function QTL 35 4.36965 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 729470 86724018 Rat 8662454 Vetf3 Vascular elastic tissue fragility QTL 3 27.4 artery integrity trait (VT:0010639) number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562) 5 2282226 69540447 Rat 2290448 Scl54 Serum cholesterol level QTL 54 2.93 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 5 31663789 131345958 Rat 6903292 Stl28 Serum triglyceride level QTL 28 2.6 0.0073 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 5 28515489 73515489 Rat 61462 Niddm10 Non-insulin dependent diabetes mellitus QTL 10 3.9 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 5 5112159 47171491 Rat 1641903 Alcrsp3 Alcohol response QTL 3 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 5 12689285 57689285 Rat 1578767 Stresp17 Stress response QTL 17 4.3 0.01 blood aldosterone amount (VT:0005346) plasma aldosterone level (CMO:0000551) 5 27955440 72955440 Rat 1331756 Rf34 Renal function QTL 34 4.16275 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 5 1 90450412 Rat 8552954 Pigfal14 Plasma insulin-like growth factor 1 level QTL 14 9 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 5 21226744 66226744 Rat 1549901 Neudeg2 Neurodegradation QTL 2 4 0 nervous system integrity trait (VT:0010566) mononuclear cell count (CMO:0002119) 5 24838710 44045280 Rat 1600358 Mamtr5 Mammary tumor resistance QTL 5 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 5 18873947 63873947 Rat
RH139338
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 5 37,811,974 - 37,812,098 (+) Marker Load Pipeline mRatBN7.2 5 33,015,066 - 33,015,189 (+) MAPPER mRatBN7.2 Rnor_6.0 5 33,525,716 - 33,525,838 NCBI Rnor6.0 Rnor_5.0 5 38,180,120 - 38,180,242 UniSTS Rnor5.0 RGSC_v3.4 5 34,155,079 - 34,155,201 UniSTS RGSC3.4 Celera 5 32,105,201 - 32,105,323 UniSTS RH 3.4 Map 18 448.5 UniSTS Cytogenetic Map 5 q13 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000008281 ⟹ ENSRNOP00000008281
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 5 33,016,307 - 33,063,934 (-) Ensembl Rnor_6.0 Ensembl 5 33,528,154 - 33,574,596 (-) Ensembl
RefSeq Acc Id:
NM_001107917 ⟹ NP_001101387
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 5 37,811,566 - 37,860,840 (-) NCBI mRatBN7.2 5 33,014,658 - 33,063,934 (-) NCBI Rnor_6.0 5 33,529,194 - 33,560,043 (-) NCBI Rnor_5.0 5 38,179,711 - 38,229,012 (-) NCBI RGSC_v3.4 5 34,154,672 - 34,203,959 (-) RGD Celera 5 32,108,679 - 32,139,506 (-) NCBI
Sequence:
ATGGCTGCGCAGTGCGTCACGAAGGTGGAGCTAAATATTTCCTGTAACAGCCTTTTGGATACTGATCTAACGTCAAAGTCCGACCCTTTATGTGTGTTGTTTTTGAACACCAGTGGTCAACAGTGGTA
hide sequence
RefSeq Acc Id:
NP_001101387 ⟸ NM_001107917
- UniProtKB:
D3ZLA3 (UniProtKB/TrEMBL), A6IIC6 (UniProtKB/TrEMBL)
- Sequence:
MAAQCVTKVELNISCNSLLDTDLTSKSDPLCVLFLNTSGQQWYEVERTERIKNSLNPKFSKTFVIDYYFEVVQKLKFGIYDIDNKTIELSDDDFLGECEVTLGQIVSSKKLTRPLVLKNGKPAGQGSI
hide sequence
Ensembl Acc Id:
ENSRNOP00000008281 ⟸ ENSRNOT00000008281
RGD ID: 13693588 Promoter ID: EPDNEW_R4112 Type: initiation region Name: Cpne3_1 Description: copine 3 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 5 33,574,547 - 33,574,607 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-03
Cpne3
copine 3
Cpne3
copine III
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
Cpne3
copine III
Cpne3_predicted
copine III (predicted)
'predicted' is removed
2292626 APPROVED
2005-01-12
Cpne3_predicted
copine III (predicted)
Symbol and Name status set to approved
70820 APPROVED
