Advanced Search (OLGA)

Gene: Eid2b (EP300 interacting inhibitor of differentiation 2B) Rattus norvegicus

Subscribe to Updates

Analyze

Symbol:

Eid2b

Name:

EP300 interacting inhibitor of differentiation 2B

RGD ID:

9381183

Description:

Predicted to enable identical protein binding activity. Predicted to be involved in negative regulation of DNA-templated transcription and negative regulation of myoblast differentiation. Predicted to be located in nucleus. Orthologous to human EID2B (EP300 interacting inhibitor of differentiation 2B); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; bisphenol A; cobalt dichloride.

Type:

protein-coding (Ensembl: lncRNA)

RefSeq Status:

VALIDATED

Previously known as:

EP300-interacting inhibitor of differentiation 2B; RGD1560818; RGD9381183

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	92,673,119 - 92,674,899 (+)	NCBI		GRCr8
mRatBN7.2	1	83,545,530 - 83,547,338 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	83,545,563 - 83,546,734 (-)	Ensembl		mRatBN7.2 Ensembl
Rnor_6.0	1	85,508,397 - 85,510,131 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	85,509,662 - 85,510,114 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Celera	1	77,944,621 - 77,946,356 (+)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eid2b	Rat	Carpenter syndrome 2		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Carpenter syndrome 2	ClinVar	PMID:28492532
Eid2b	Rat	congenital hypoplastic anemia		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Congenital hypoplastic anemia	ClinVar	PMID:28492532
Eid2b	Rat	craniosynostosis 1		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: TWIST1-related craniosynostosis	ClinVar	PMID:28492532
Eid2b	Rat	Diamond-Blackfan anemia		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Aase syndrome	ClinVar	PMID:28492532
Eid2b	Rat	maple syrup urine disease		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Maple syrup urine disease	ClinVar	PMID:28492532
Eid2b	Rat	maturity-onset diabetes of the young type 1		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Type 2 diabetes mellitus	ClinVar	PMID:28492532
Eid2b	Rat	type 2 diabetes mellitus		ISO	EID2B (Homo sapiens)	8554872	ClinVar Annotator: match by term: Type 2 diabetes mellitus	ClinVar	PMID:28492532

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eid2b	Rat	(1->4)-beta-D-glucan	multiple interactions	ISO	Eid2b (Mus musculus)	6480464	[perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of EID2B mRNA	CTD	PMID:36331819
Eid2b	Rat	1,2-dichloroethane	decreases expression	ISO	Eid2b (Mus musculus)	6480464	ethylene dichloride results in decreased expression of EID2B mRNA	CTD	PMID:28960355
Eid2b	Rat	2,3,7,8-tetrachlorodibenzodioxine	affects expression	ISO	EID2B (Homo sapiens)	6480464	Tetrachlorodibenzodioxin affects the expression of EID2B mRNA	CTD	PMID:22574217
Eid2b	Rat	2,3,7,8-tetrachlorodibenzodioxine	decreases expression	EXP		6480464	Tetrachlorodibenzodioxin results in decreased expression of EID2B mRNA	CTD	PMID:32109520
Eid2b	Rat	acrylamide	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Acrylamide results in decreased expression of EID2B mRNA	CTD	PMID:32763439
Eid2b	Rat	aflatoxin B1	affects expression	ISO	EID2B (Homo sapiens)	6480464	Aflatoxin B1 affects the expression of EID2B protein	CTD	PMID:20106945
Eid2b	Rat	aflatoxin B1	increases methylation	ISO	EID2B (Homo sapiens)	6480464	Aflatoxin B1 results in increased methylation of EID2B gene	CTD	PMID:27153756
Eid2b	Rat	aflatoxin B1	increases expression	ISO	EID2B (Homo sapiens)	6480464	Aflatoxin B1 results in increased expression of EID2B mRNA	CTD	PMID:21632981 and PMID:21641981
Eid2b	Rat	benzo[a]pyrene	increases expression	ISO	EID2B (Homo sapiens)	6480464	Benzo(a)pyrene results in increased expression of EID2B mRNA	CTD	PMID:21632981
Eid2b	Rat	benzo[a]pyrene	increases methylation	ISO	EID2B (Homo sapiens)	6480464	Benzo(a)pyrene results in increased methylation of EID2B promoter	CTD	PMID:27901495
Eid2b	Rat	bisphenol A	increases expression	EXP		6480464	bisphenol A results in increased expression of EID2B mRNA	CTD	PMID:25181051
Eid2b	Rat	cisplatin	increases expression	ISO	EID2B (Homo sapiens)	6480464	Cisplatin results in increased expression of EID2B mRNA	CTD	PMID:27392435
Eid2b	Rat	cisplatin	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[Cisplatin co-treated with jinfukang] results in increased expression of EID2B mRNA	CTD	PMID:27392435
Eid2b	Rat	cobalt dichloride	decreases expression	EXP		6480464	cobaltous chloride results in decreased expression of EID2B mRNA	CTD	PMID:24386269
Eid2b	Rat	copper(II) sulfate	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Copper Sulfate results in decreased expression of EID2B mRNA	CTD	PMID:19549813
Eid2b	Rat	crocidolite asbestos	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Asbestos and Crocidolite results in decreased expression of EID2B mRNA	CTD	PMID:29523930
Eid2b	Rat	cyclosporin A	increases expression	ISO	EID2B (Homo sapiens)	6480464	Cyclosporine results in increased expression of EID2B mRNA	CTD	PMID:20106945
Eid2b	Rat	cyclosporin A	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Cyclosporine results in decreased expression of EID2B mRNA	CTD	PMID:25562108
Eid2b	Rat	Dibutyl phosphate	affects expression	ISO	EID2B (Homo sapiens)	6480464	di-n-butylphosphoric acid affects the expression of EID2B mRNA	CTD	PMID:37042841
Eid2b	Rat	dorsomorphin	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ...	CTD	PMID:27188386
Eid2b	Rat	ethyl methanesulfonate	increases expression	ISO	EID2B (Homo sapiens)	6480464	Ethyl Methanesulfonate results in increased expression of EID2B mRNA	CTD	PMID:23649840
Eid2b	Rat	folic acid	decreases expression	ISO	Eid2b (Mus musculus)	6480464	Folic Acid results in decreased expression of EID2B mRNA	CTD	PMID:25629700
Eid2b	Rat	formaldehyde	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Formaldehyde results in decreased expression of EID2B mRNA	CTD	PMID:20655997
Eid2b	Rat	formaldehyde	increases expression	ISO	EID2B (Homo sapiens)	6480464	Formaldehyde results in increased expression of EID2B mRNA	CTD	PMID:23649840
Eid2b	Rat	lead(0)	affects expression	ISO	EID2B (Homo sapiens)	6480464	Lead affects the expression of EID2B mRNA	CTD	PMID:28903495
Eid2b	Rat	methyl methanesulfonate	increases expression	ISO	EID2B (Homo sapiens)	6480464	Methyl Methanesulfonate results in increased expression of EID2B mRNA	CTD	PMID:23649840
Eid2b	Rat	methylmercury chloride	decreases expression	ISO	EID2B (Homo sapiens)	6480464	methylmercuric chloride results in decreased expression of EID2B mRNA	CTD	PMID:28001369
Eid2b	Rat	ozone	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[Air Pollutants results in increased abundance of Ozone] which affects the expression of EID2B mRNA	CTD	PMID:35430440
Eid2b	Rat	p-chloromercuribenzoic acid	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EID2B mRNA	CTD	PMID:27188386
Eid2b	Rat	perfluorooctane-1-sulfonic acid	multiple interactions	ISO	Eid2b (Mus musculus)	6480464	[perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of EID2B mRNA	CTD	PMID:36331819
Eid2b	Rat	phenylmercury acetate	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Phenylmercuric Acetate results in decreased expression of EID2B mRNA	CTD	PMID:26272509
Eid2b	Rat	phenylmercury acetate	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EID2B mRNA	CTD	PMID:27188386
Eid2b	Rat	quercetin	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Quercetin results in decreased expression of EID2B mRNA	CTD	PMID:21632981
Eid2b	Rat	SB 431542	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ...	CTD	PMID:27188386
Eid2b	Rat	sunitinib	increases expression	ISO	EID2B (Homo sapiens)	6480464	Sunitinib results in increased expression of EID2B mRNA	CTD	PMID:31533062
Eid2b	Rat	temozolomide	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Temozolomide results in decreased expression of EID2B mRNA	CTD	PMID:31758290
Eid2b	Rat	thioacetamide	decreases expression	EXP		6480464	Thioacetamide results in decreased expression of EID2B mRNA	CTD	PMID:34492290
Eid2b	Rat	titanium dioxide	decreases expression	ISO	Eid2b (Mus musculus)	6480464	titanium dioxide results in decreased expression of EID2B mRNA	CTD	PMID:29264374
Eid2b	Rat	trichloroethene	increases expression	EXP		6480464	Trichloroethylene results in increased expression of EID2B mRNA	CTD	PMID:33387578
Eid2b	Rat	trichostatin A	decreases expression	ISO	EID2B (Homo sapiens)	6480464	trichostatin A results in decreased expression of EID2B mRNA	CTD	PMID:24935251 and PMID:26272509
Eid2b	Rat	trichostatin A	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EID2B mRNA	CTD	PMID:27188386
Eid2b	Rat	trovafloxacin	increases expression	ISO	Eid2b (Mus musculus)	6480464	trovafloxacin results in increased expression of EID2B mRNA	CTD	PMID:35537566
Eid2b	Rat	urethane	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Urethane results in decreased expression of EID2B mRNA	CTD	PMID:28818685
Eid2b	Rat	valproic acid	decreases expression	ISO	EID2B (Homo sapiens)	6480464	Valproic Acid results in decreased expression of EID2B mRNA	CTD	PMID:23179753 more ...
Eid2b	Rat	valproic acid	multiple interactions	ISO	EID2B (Homo sapiens)	6480464	[NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of EID2B mRNA	CTD	PMID:27188386

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eid2b	Rat	negative regulation of DNA-templated transcription	involved_in	ISO	EID2B (Homo sapiens)	1624291	PMID:15970276	RGD	PMID:15970276
Eid2b	Rat	negative regulation of myoblast differentiation	involved_in	ISO	EID2B (Homo sapiens)	1624291	PMID:15970276	RGD	PMID:15970276

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eid2b	Rat	nucleus	located_in	ISO	EID2B (Homo sapiens)	1624291	PMID:15970276	RGD	PMID:15970276

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Eid2b	Rat	identical protein binding	enables	ISO	EID2B (Homo sapiens)	1624291	UniProtKB:Q96D98 and PMID:15970276	RGD	PMID:15970276
Eid2b	Rat	protein binding	enables	ISO	EID2B (Homo sapiens)	1624291	UniProtKB:P15289 more ...	RGD	PMID:15970276 more ...

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Eid2b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	92,673,119 - 92,674,899 (+)	NCBI		GRCr8
mRatBN7.2	1	83,545,530 - 83,547,338 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	83,545,563 - 83,546,734 (-)	Ensembl		mRatBN7.2 Ensembl
Rnor_6.0	1	85,508,397 - 85,510,131 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	85,509,662 - 85,510,114 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Celera	1	77,944,621 - 77,946,356 (+)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

EID2B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	39,530,987 - 39,532,852 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	19	39,530,987 - 39,532,852 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	19	40,021,627 - 40,023,492 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	44,713,470 - 44,715,334 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	19	36,823,341 - 36,825,205 (-)	NCBI		Celera
Cytogenetic Map	19	q13.2	NCBI
HuRef	19	36,467,983 - 36,469,847 (-)	NCBI		HuRef
CHM1_1	19	40,022,235 - 40,024,098 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	19	42,335,245 - 42,337,110 (-)	NCBI		T2T-CHM13v2.0

Eid2b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	7	27,977,152 - 27,978,916 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	7	27,977,164 - 27,978,914 (+)	Ensembl		GRCm39 Ensembl
GRCm38	7	28,277,706 - 28,280,129 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	7	28,277,739 - 28,279,489 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	7	29,062,725 - 29,065,148 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	7	27,986,400 - 27,987,754 (+)	NCBI		MGSCv36	mm8
Celera	7	22,839,330 - 22,841,753 (+)	NCBI		Celera
Cytogenetic Map	7	A3	NCBI
cM Map	7	16.67	NCBI

Eid2b
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0	NW_004955468	48,573 - 50,029 (+)	NCBI	ChiLan1.0	ChiLan1.0

EID2B
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	20	45,823,975 - 45,828,655 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	19	47,694,559 - 47,699,595 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	19	36,629,480 - 36,631,665 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	19	45,177,751 - 45,179,081 (-)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	19	45,178,537 - 45,179,022 (-)	Ensembl	panpan1.1		panPan2

Eid2b
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024409349	13,923,971 - 13,926,929 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936661	2,354,497 - 2,354,966 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936661	2,352,726 - 2,354,968 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

EID2B
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	6	34,131,492 - 34,133,542 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	6	34,132,832 - 34,133,317 (-)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666073	12,154,801 - 12,156,692 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Eid2b
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla 1.0	NW_004624794	12,826,376 - 12,827,772 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants in Eid2b
14 total Variants

Assembly: mRatBN7.2

Chromosome	Start Pos	End Pos	Reference Nucleotide	Variant Nucleotide	Variant Type	Strain	Variant Page
1	83546068	83546069	G	A	snv	BXH2/CubMcwi (2020), WKY/NCrl (2019NG), HXB10/IpcvMcwi (2019), HXB2/IpcvMcwi (2019), HXB4/IpcvMcwi (2020), SHR/OlalpcvMcwi (2019), WKY/NCrl (2019), WKY/N (2020), BXH6/CubMcwi (2021), European Variation Archive Release 3, European Variation Archive Release 4, European Variation Archive Release 6, HXB23/IpcvMcwi (2021), SHR/NCrl (2021), SHR/NHsd (2021), SHR/NHsd (2021), SHR/OlalpcvMcwi (2019NG), BXH3/CubMcwi (2020)	View more Information

Assembly: Rnor_6.0

Chromosome	Start Pos	End Pos	Reference Nucleotide	Variant Nucleotide	Variant Type	Strain	Variant Page
1	85509667	85509668	C	T	snv	SHR/NHsd (RGD), WKY/NCrl (RGD), WKY/Gcrc (RGD), BXH2/CubMcwi (2020), BXH3/CubMcwi (2020), HXB10/IpcvMcwi (2019), European Variation Archive Release 6, HXB4/IpcvMcwi (2020), SHR/OlalpcvMcwi (2019), WKY/NCrl (2019), WKY/N (2020), European Variation Archive Release 3, European Variation Archive Release 4, HXB2/IpcvMcwi (2019)	View more Information

Predicted Target Of

	Summary Value
Count of predictions:	12
Count of miRNA genes:	11
Interacting mature miRNAs:	12
Transcripts:	ENSRNOT00000074665
Prediction methods:	Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2313059	Bss55	Bone structure and strength QTL 55	3.2	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	49393172	94393172	Rat
1582234	Gluco18	Glucose level QTL 18	3.4	0.0003	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	78479925	123479925	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	30882023	123479925	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
1554320	Bmd1	Bone mineral density QTL 1	12.2	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	1	509108	86060548	Rat
2302059	Pia36	Pristane induced arthritis QTL 36	3.8	0.001	blood immunoglobulin amount (VT:0002460)	serum immunoglobulin G1 level (CMO:0002115)	1	43333002	88333002	Rat
1300121	Hrtrt1	Heart rate QTL 1	3.7		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	65789093	115540829	Rat
7421628	Bp361	Blood pressure QTL 361		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	66023617	118608521	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	22340647	102268831	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
631512	Scl6	Serum cholesterol level QTL 6	9.6		blood cholesterol amount (VT:0000180)	serum total cholesterol level (CMO:0000363)	1	72197680	90508767	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	57336763	151090257	Rat
2313072	Bss53	Bone structure and strength QTL 53	4.3	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	43284731	118944897	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
2313078	Bss54	Bone structure and strength QTL 54	3.5	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
1549903	Bp267	Blood pressure QTL 267			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	77876254	106047988	Rat
2313083	Bmd74	Bone mineral density QTL 74	4	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	82174743	118944897	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	48963584	144267916	Rat
4889494	Scort2	Serum corticosterone level QTL 2	4.2		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	1	80592172	125592172	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	56732668	98773277	Rat
1300172	Bp172	Blood pressure QTL 172	3.56		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	32737273	90665040	Rat
61344	Bp29	Blood pressure QTL 29	7.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	78350581	123350581	Rat
1358192	Ept13	Estrogen-induced pituitary tumorigenesis QTL 13	3.4		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	77494165	122494165	Rat
2313094	Bss58	Bone structure and strength QTL 58	3.7	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	43284731	118944897	Rat
6903308	Scl36	Serum cholesterol QTL 36	2	0.0125	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	53863041	90532583	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	56949932	101949932	Rat
2313099	Bss56	Bone structure and strength QTL 56	2.4	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	1	43284731	118944897	Rat
2313098	Bmd70	Bone mineral density QTL 70	3.6	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	43284731	118944897	Rat
152025249	Scl82	Serum cholesterol level QTL 82	4.77		blood cholesterol amount (VT:0000180)		1	50343510	99980958	Rat
10054135	Gmadr2	Adrenal mass QTL 2	1.97	0.0129	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	77857876	122857876	Rat
7411712	Strs4	Sensitivity to stroke QTL 4	8.7		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	1	78430536	123430536	Rat
2313051	Bss57	Bone structure and strength QTL 57	3.7	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	43284731	118944897	Rat
61433	Cia2	Collagen induced arthritis QTL 2	5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	78430754	91209302	Rat

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
9	11	49	113	91	90	59	25	59	6	218	97	93	45	60	31


RefSeq Transcripts	NM_001329142	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000001	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000074665 ⟹ ENSRNOP00000067743

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	1	83,545,563 - 83,546,734 (-)	Ensembl
Rnor_6.0 Ensembl	1	85,509,662 - 85,510,114 (-)	Ensembl

RefSeq Acc Id:

NM_001329142 ⟹ NP_001316071

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	92,673,119 - 92,674,899 (+)	NCBI
mRatBN7.2	1	83,545,558 - 83,547,338 (+)	NCBI
Rnor_6.0	1	85,508,397 - 85,510,131 (-)	NCBI
Celera	1	77,944,621 - 77,946,356 (+)	NCBI

Sequence:

show sequence

GGACTCAACGGTCCGCAATGTCCGAGCTGCCCGGAGAAAGCAGGATCCCGGACCTGTGCCCTATGAACGGCGTCGGCAACGTCCTGCAGGCGGGAGTGGGCGGAGGCAATCGGGTCCCCGAAGCCCTG
GAAGGCCCGCTGGCCAGAGCCGCCCGGACCATGGCGCGGGCTCCGGGCCTGGCTCCCGGGCCGTTCCCCGGCATGGCGGGCCTGATGGCCATACCGCACGTCCCCCCGCCGCTCCGCCTTCTAGAGCT
GCACGAGCAGCGGATGTTCGAACACTACCTGCACACCAACCCCCTGATCCCCACCAGGCTGCTCCGCGAAATCGAGGAGCGTCGCCGGCTGTTCGTGGAGGGCTGCAGGGCCAGGGAGGCGGCCTTCG
ACGCCGACCCCCCGCAGTTGGACTCGGAGGCCCGCGCCTTCACGCTGGCGCTCACGGCCTCCGACGCCCACGGCCCCACCGCAGACTGAGGGTTGGCCTTTGCCTATAATCTCAGTCCTCAGGAGGGA
GGAAGCCTGAGGATCCAGAGTTCAAGATCATCCTCCGCTATGTAGCGAGTTGGAGGCCAGCCTGGGCTACAGGAGACTCTGTCTTTTAAAAATAATAAAACAAAAAAGATTGGTGGCCAGGAAGTCAG
GTGACTCTTAGGATCAAGGGCAAAGGCAGATGTCCAGGCAAATGTCATGAGGTGGGAAATCCAAGCCAGAATACAGCCAAGGGCTGGGTGGAATGAAGCAGGCCCAGAAAGAGATGGACACTCGAGGC
TTGAGGCTGACAAGCAAAGAGGACTCTTCTGACTTCCACCTTGTGACTGTCAGCAATCTTTCCCTCCCCTGCTTTCGTTGAAAATCATGTTTTTTTTTTCCACAGGGAAGGACGATGGTTTTGCAAAG
ATGAAGTCTTAAGAATTACCAATGAAAAGACGGAGATGCGGAAAGAAACCAGGGAAATGTGATTGTTAGATTCAGTTGCTTCTGGGTTTTATTGGAGTAAGAAGAAGGCTGTTGAAACAACGTGGACA
TTTCAGAATTGTGGGGTCACCTCATTGTCAGCTGACAAGCTCAATGTATCGTTAATTCTTGTGTTTGGTGTTCTGTAGATAAGTTGTAAATATTCAGATAGGGAAAATCTATGTGCGTTGTGAGATGA
ATATTTTTCAAGACCTTGTGTAATTGTATCCATGTGGAAAAAGATGAGTTAGTATTTAAAGGATACGGACACAAGACTCAAAATTAGCAAAAGATACTAAGGGAAGGTTAAACTTTTCTGCCAAATTG
AAAACAGGTGTCCATACAGATTTGGGTTAGGGTGGGAAGTTGTTTTCTGTAGGGTCTTCAAAACCATTTTATAAGGCGTATATGAATTGGTACCAATCCAGTTATCCCCCAATCCTGGGTGCTGAAGA
TGGATCCCAGGCCTTGCCCTGCTCCCAGTCCTCCTGAATCAAGGTAAGATAGGATCATGGCCCAGTGGTCAAAAATGTCCGCTGCTCAGCCTTGTTACTGAGTTTGATCCCGGGACCCACGAGGTGGA
AGAAGAAACCACACCCATGTCCTCCGAGCAGCACGCACACGTGCACACACTCATGCAATGTAAAGAAATCTACATAGTACATATATCGGCATCTTGGGTTCTTATGTTACAATGGAAGTGATCCTCCA
TCGTTTTGTCCTTAATGACTACTATCGGAGTCTGTATCTTAACTTATCTAATGAACTAGTTGTCTTCTGGA

hide sequence


Protein RefSeqs	NP_001316071	(Get FASTA)	NCBI Sequence Viewer

RefSeq Acc Id:	NP_001316071 ⟸ NM_001329142
- UniProtKB:	M0RDN8 (UniProtKB/TrEMBL)
- Sequence:	show sequence MSELPGESRIPDLCPMNGVGNVLQAGVGGGNRVPEALEGPLARAARTMARAPGLAPGPFPGMAGLMAIPHVPPPLRLLELHEQRMFEHYLHTNPLIPTRLLREIEERRRLFVEGCRAREAAFDADPPQ LDSEARAFTLALTASDAHGPTAD hide sequence

Ensembl Acc Id:

ENSRNOP00000067743 ⟸ ENSRNOT00000074665

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-M0RDN8-F1-model_v2	AlphaFold	M0RDN8	1-151	view protein structure

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

RGD ID:

13689883

Promoter ID:

EPDNEW_R402

Type:

single initiation site

Name:

Eid2b_1

Description:

EP300 interacting inhibitor of differentiation 2B

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	1	85,510,165 - 85,510,225	EPDNEW

Database	Acc Id	Source(s)
Ensembl Genes	ENSRNOG00000045545	Ensembl
NCBI Gene	Eid2b	ENTREZGENE
PhenoGen	Eid2b	PhenoGen
RatGTEx	ENSRNOG00000045545	RatGTEx
RNAcentral	URS00022B36A9	RNACentral
UniProt	M0RDN8	ENTREZGENE

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2010-04-23	Eid2b	EP300 interacting inhibitor of differentiation 2B	RGD1560818	similar to hypothetical protein FLJ38944	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2008-04-30	RGD1560818	similar to hypothetical protein FLJ38944	RGD1560818_predicted	similar to hypothetical protein FLJ38944 (predicted)	'predicted' is removed	2292626	APPROVED
2006-03-07	RGD1560818_predicted	similar to hypothetical protein FLJ38944 (predicted)	LOC499112	similar to hypothetical protein FLJ38944	Symbol and Name status set to approved	1299863	APPROVED
2006-02-09	LOC499112	similar to hypothetical protein FLJ38944			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message

Imported Disease Annotations - ClinVar