Advanced Search (OLGA)

Gene: LOC102548014 (uncharacterized LOC102548014) Rattus norvegicus

Subscribe to Updates

Analyze

Symbol:

LOC102548014

Name:

uncharacterized LOC102548014

RGD ID:

7598618

Description:

Type:

ncrna

RefSeq Status:

MODEL

Previously known as:

LOC102553491; uncharacterized LOC102553491

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	100,232,648 - 100,265,328 (-)	NCBI		GRCr8
mRatBN7.2	1	91,105,758 - 91,128,497 (-)	NCBI	mRatBN7.2	mRatBN7.2
Rnor_6.0	1	95,398,041 - 95,424,141 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_5.0	1	96,513,970 - 96,515,250 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	1	85,432,877 - 85,458,977 (-)	NCBI		Celera
Cytogenetic Map	1	q21	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Variants in LOC102548014
155 total Variants

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2313059	Bss55	Bone structure and strength QTL 55	3.2	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
631688	Hcas2	Hepatocarcinoma susceptibility QTL 2	3	0.0001	liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	1	5925874	115540829	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	49393172	94393172	Rat
1582234	Gluco18	Glucose level QTL 18	3.4	0.0003	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	78479925	123479925	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	30882023	123479925	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	49393289	199050459	Rat
1578780	Cm52	Cardiac mass QTL 52	3.3	0.0001	heart mass (VT:0007028)	heart wet weight (CMO:0000069)	1	81591954	219808434	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	49393172	159356837	Rat
2300324	Fetw1	Fetal weight QTL 1	12.1	0.005	fetal growth trait (VT:0004201)	fetal body weight (CMO:0002080)	1	85424647	100358001	Rat
1300121	Hrtrt1	Heart rate QTL 1	3.7		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	1	65789093	115540829	Rat
7421628	Bp361	Blood pressure QTL 361		0.001	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	1	66023617	118608521	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	22340647	102268831	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32356093	162846471	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	57336763	151090257	Rat
2313072	Bss53	Bone structure and strength QTL 53	4.3	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	43284731	118944897	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	32737458	199368955	Rat
2313078	Bss54	Bone structure and strength QTL 54	3.5	0.0001	tibia area (VT:1000281)	tibia midshaft cross-sectional area (CMO:0001717)	1	43284731	118944897	Rat
1302788	Scl19	Serum cholesterol QTL 19	4.6	0.001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	90532338	123479925	Rat
1549903	Bp267	Blood pressure QTL 267			arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	77876254	106047988	Rat
2313083	Bmd74	Bone mineral density QTL 74	4	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	82174743	118944897	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	48963584	144267916	Rat
4889494	Scort2	Serum corticosterone level QTL 2	4.2		blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	1	80592172	125592172	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	56732668	98773277	Rat
61344	Bp29	Blood pressure QTL 29	7.5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	78350581	123350581	Rat
724521	Uae1	Urinary albumin excretion QTL 1	3.8	0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	1	90508614	173018436	Rat
1358902	Bw47	Body weight QTL 47	1.67		body mass (VT:0001259)	body weight (CMO:0000012)	1	90508614	180359386	Rat
1358192	Ept13	Estrogen-induced pituitary tumorigenesis QTL 13	3.4		pituitary gland mass (VT:0010496)	pituitary gland wet weight (CMO:0000853)	1	77494165	122494165	Rat
2313094	Bss58	Bone structure and strength QTL 58	3.7	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	43284731	118944897	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	56949932	101949932	Rat
2313099	Bss56	Bone structure and strength QTL 56	2.4	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	1	43284731	118944897	Rat
2313098	Bmd70	Bone mineral density QTL 70	3.6	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	43284731	118944897	Rat
1300153	Bp171	Blood pressure QTL 171	3.37		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	90664883	143200202	Rat
738022	Anxrr13	Anxiety related response QTL 13	4.6	0.00039	locomotor behavior trait (VT:0001392)	number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)	1	83547917	128547917	Rat
152025249	Scl82	Serum cholesterol level QTL 82	4.77		blood cholesterol amount (VT:0000180)		1	50343510	99980958	Rat
10054135	Gmadr2	Adrenal mass QTL 2	1.97	0.0129	adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	77857876	122857876	Rat
7411712	Strs4	Sensitivity to stroke QTL 4	8.7		cerebrum integrity trait (VT:0010549)	percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)	1	78430536	123430536	Rat
2313051	Bss57	Bone structure and strength QTL 57	3.7	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	43284731	118944897	Rat
61433	Cia2	Collagen induced arthritis QTL 2	5		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	1	78430754	91209302	Rat
724529	Cm16	Cardiac mass QTL 16	2.7		heart mass (VT:0007028)	calculated heart weight (CMO:0000073)	1	87580395	150700247	Rat

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.


RefSeq Transcripts	XR_001835354	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_001835355	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_001835735	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_001835736	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_010062994	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XR_010062995	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000001	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XR_001835735

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	100,232,648 - 100,265,186 (-)	NCBI
mRatBN7.2	1	91,105,758 - 91,128,497 (-)	NCBI
Rnor_6.0	1	95,401,453 - 95,424,141 (-)	NCBI

Sequence:

show sequence

CTCAGCAGGGAGCAGCCAGACACTGGCGACAGGACGAGGCAGAGAATCCCAGAGACGGAGAGGGAGAAGAAGCACCTGACAGAGGCACGTCTCAGCCAACACATTCTGGTCTTGAGCTGCCTTGCTTC
CCACCGTGATACTAATGGACTGGACCTCTGAACCTGTAAGCCAGCTCCAATTAAATGTTGTCCTTGTTAAGTGTTGCCTTGGTCATGGTGTCTCTTCACAGCAATGGAGAACCTAAAACATAAGTTAG
CACCATGGACTGGAGTATGGCTGTTATAGGTAACCATGCTTTTGCTTGAAAGAATGTGGATTTTGTGACTTTGGAAAGCAGTGGGATGCTTTAAGAGAGCCTTAATGGGCTATCCTAGTAGGAATGTA
GAAGACTTTCCTGCTGCGGAAATTTGAACTCTGAGACCCTGGCTCTAGAGGTTTCAGAGAAGAGGGATTTTAACAGGTTGCTTGAAGATGGCTGTGATATTTCAGTGAAGAACGTGGCTGCTTTTTGA
CCTTATCTAAAGAGTCTATCTCAGGCTAAGATAAAGAGATTTCAATTAATTGCATTCATAGAGGAAGTCTCAGAAAAGCCCAGCATAGACTTTGTCCTCTGGTTTACTCTCATGAAAAGGTGTTTTGA
TCAAGTATAGCAAGGTTAGAAAGAAAAAAGTACAAAATGTATGGTTCAAATAATAAAGGGACACCAAGAAGTACAATGGA

hide sequence

RefSeq Acc Id:

XR_010062994

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	100,232,648 - 100,265,328 (-)	NCBI

RefSeq Acc Id:

XR_010062995

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	100,232,648 - 100,265,186 (-)	NCBI

Database	Acc Id	Source(s)
BioCyc Gene	G2FUF-59918	BioCyc
NCBI Gene	LOC102548014	ENTREZGENE
PhenoGen	LOC102548014	PhenoGen
RNAcentral	URS0000CCE8A0	RNACentral
	URS0000CD0A8A	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2021-03-09	LOC102548014	uncharacterized LOC102548014	LOC102553491	uncharacterized LOC102553491	Data merged from RGD:7611246	737654	PROVISIONAL
2013-12-18	LOC102548014	uncharacterized LOC102548014			Symbol and Name status set to provisional	70820	PROVISIONAL
2013-12-18	LOC102553491	uncharacterized LOC102553491			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Send us a Message