Symbol:
Exoc8
Name:
exocyst complex component 8
RGD ID:
620245
Description:
Predicted to enable phosphatidylinositol binding activity and small GTPase binding activity. Predicted to be involved in several processes, including Golgi to plasma membrane transport; endosome organization; and extracellular matrix disassembly. Predicted to act upstream of or within exocytosis. Located in cell leading edge. Part of exocyst. Orthologous to human EXOC8 (exocyst complex component 8); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,4-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
Exo84; exocyst complex 84 kDa subunit; exocyst complex 84-kDa subunit
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
EXOC8 (exocyst complex component 8) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, PhylomeDB
Mus musculus (house mouse):
Exoc8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Exoc8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
EXOC8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
EXOC8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Exoc8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
EXOC8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
EXOC8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Exoc8 (exocyst complex component 8) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
EXOC8 (exocyst complex component 8)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Exoc8 (exocyst complex component 8)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
exoc8 (exocyst complex component 8)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
EXO84
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Drosophila melanogaster (fruit fly):
Exo84
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
exoc-8
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
exoc8
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 69,752,387 - 69,754,876 (-) NCBI GRCr8 mRatBN7.2 19 52,855,010 - 52,857,499 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 52,852,578 - 52,857,491 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 59,639,787 - 59,642,276 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 60,490,839 - 60,493,328 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 62,566,254 - 62,568,743 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 57,647,305 - 57,649,794 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 57,647,291 - 57,649,827 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 68,360,544 - 68,363,033 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 55,066,272 - 55,068,761 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 19 55,071,156 - 55,073,642 (-) NCBI Celera 19 52,222,177 - 52,224,666 (-) NCBI Celera Cytogenetic Map 19 q12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Exoc8 Rat 1,2-dimethylhydrazine multiple interactions ISO Exoc8 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of EXOC8 mRNA CTD PMID:22206623 Exoc8 Rat 1,2-dimethylhydrazine decreases expression ISO Exoc8 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of EXOC8 mRNA CTD PMID:22206623 Exoc8 Rat 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of EXOC8 mRNA CTD PMID:29097150 Exoc8 Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO EXOC8 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Exoc8 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Exoc8 (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to EXOC8 promoter] CTD PMID:19654925 Exoc8 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of EXOC8 mRNA CTD PMID:33387578 Exoc8 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Exoc8 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of EXOC8 mRNA CTD PMID:21570461 Exoc8 Rat 2,4,6-tribromophenol decreases expression ISO EXOC8 (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Exoc8 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of EXOC8 mRNA CTD PMID:21346803 Exoc8 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of EXOC8 mRNA CTD PMID:21346803 Exoc8 Rat 2-hydroxypropanoic acid decreases expression ISO EXOC8 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of EXOC8 mRNA CTD PMID:30851411 Exoc8 Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO EXOC8 (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of EXOC8 protein CTD PMID:31675489 Exoc8 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of EXOC8 mRNA more ... CTD PMID:28628672 Exoc8 Rat 4,4'-sulfonyldiphenol multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of EXOC8 mRNA CTD PMID:28628672 Exoc8 Rat 4,4'-sulfonyldiphenol affects methylation ISO Exoc8 (Mus musculus) 6480464 bisphenol S affects the methylation of EXOC8 gene CTD PMID:31683443 Exoc8 Rat 4,4'-sulfonyldiphenol increases expression ISO EXOC8 (Homo sapiens) 6480464 bisphenol S results in increased expression of EXOC8 protein CTD PMID:34186270 Exoc8 Rat 4,4'-sulfonyldiphenol increases methylation ISO Exoc8 (Mus musculus) 6480464 bisphenol S results in increased methylation of EXOC8 exon CTD PMID:33297965 Exoc8 Rat aconitine decreases expression EXP 6480464 Aconitine results in decreased expression of EXOC8 protein CTD PMID:33236894 Exoc8 Rat aflatoxin B1 increases methylation ISO EXOC8 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of EXOC8 gene CTD PMID:28458013 Exoc8 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of EXOC8 mRNA CTD PMID:16483693 Exoc8 Rat arsane affects expression ISO EXOC8 (Homo sapiens) 6480464 Arsenic affects the expression of EXOC8 mRNA CTD PMID:18414638 Exoc8 Rat arsane multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat arsenic atom affects expression ISO EXOC8 (Homo sapiens) 6480464 Arsenic affects the expression of EXOC8 mRNA CTD PMID:18414638 Exoc8 Rat arsenic atom multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat arsenite(3-) increases methylation ISO EXOC8 (Homo sapiens) 6480464 arsenite results in increased methylation of EXOC8 promoter CTD PMID:23974009 Exoc8 Rat benzo[a]pyrene multiple interactions ISO Exoc8 (Mus musculus) 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to EXOC8 promoter] CTD PMID:19654925 Exoc8 Rat benzo[a]pyrene affects methylation ISO EXOC8 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of EXOC8 3' UTR and Benzo(a)pyrene affects the methylation of EXOC8 exon CTD PMID:27901495 Exoc8 Rat benzo[a]pyrene increases expression ISO Exoc8 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of EXOC8 mRNA CTD PMID:22228805 Exoc8 Rat benzo[a]pyrene diol epoxide I decreases expression ISO EXOC8 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Exoc8 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of EXOC8 mRNA CTD PMID:25181051 Exoc8 Rat bisphenol A decreases expression ISO EXOC8 (Homo sapiens) 6480464 bisphenol A results in decreased expression of EXOC8 protein CTD PMID:34186270 Exoc8 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of EXOC8 mRNA CTD PMID:34947998 Exoc8 Rat bisphenol A decreases methylation ISO Exoc8 (Mus musculus) 6480464 bisphenol A results in decreased methylation of EXOC8 promoter CTD PMID:27312807 Exoc8 Rat bisphenol A increases methylation EXP 6480464 bisphenol A results in increased methylation of EXOC8 gene CTD PMID:28505145 Exoc8 Rat bisphenol A multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of EXOC8 mRNA CTD PMID:28628672 Exoc8 Rat bisphenol AF increases expression ISO EXOC8 (Homo sapiens) 6480464 bisphenol AF results in increased expression of EXOC8 protein CTD PMID:34186270 Exoc8 Rat bisphenol F multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of EXOC8 mRNA CTD PMID:28628672 Exoc8 Rat cadmium dichloride decreases expression ISO EXOC8 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of EXOC8 mRNA CTD PMID:38568856 Exoc8 Rat carbon nanotube decreases expression ISO Exoc8 (Mus musculus) 6480464 Nanotubes and Carbon analog results in decreased expression of EXOC8 mRNA CTD PMID:25554681 Exoc8 Rat CGP 52608 multiple interactions ISO EXOC8 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to EXOC8 gene] CTD PMID:28238834 Exoc8 Rat choline multiple interactions ISO Exoc8 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of EXOC8 gene CTD PMID:20938992 Exoc8 Rat cyclosporin A increases expression ISO EXOC8 (Homo sapiens) 6480464 Cyclosporine results in increased expression of EXOC8 mRNA CTD PMID:20106945 Exoc8 Rat decabromodiphenyl ether decreases expression ISO EXOC8 (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of EXOC8 protein CTD PMID:31675489 Exoc8 Rat dexamethasone multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of EXOC8 mRNA more ... CTD PMID:28628672 Exoc8 Rat dibutyl phthalate decreases expression ISO Exoc8 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of EXOC8 mRNA CTD PMID:21266533 Exoc8 Rat dibutyl phthalate increases expression ISO Exoc8 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of EXOC8 mRNA CTD PMID:17361019 and PMID:21266533 Exoc8 Rat doxorubicin decreases expression ISO EXOC8 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of EXOC8 mRNA CTD PMID:29803840 Exoc8 Rat epoxiconazole increases expression ISO Exoc8 (Mus musculus) 6480464 epoxiconazole results in increased expression of EXOC8 mRNA CTD PMID:35436446 Exoc8 Rat fisetin multiple interactions EXP 6480464 fisetin inhibits the reaction [methylmercuric chloride results in decreased expression of EXOC8 mRNA] CTD PMID:30890323 Exoc8 Rat folic acid multiple interactions ISO Exoc8 (Mus musculus) 6480464 [1 more ... CTD PMID:20938992 and PMID:22206623 Exoc8 Rat formaldehyde decreases expression ISO EXOC8 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of EXOC8 mRNA CTD PMID:20655997 Exoc8 Rat gentamycin decreases expression EXP 6480464 Gentamicins results in decreased expression of EXOC8 mRNA CTD PMID:33387578 Exoc8 Rat indometacin multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in increased expression of EXOC8 mRNA more ... CTD PMID:28628672 Exoc8 Rat ivermectin decreases expression ISO EXOC8 (Homo sapiens) 6480464 Ivermectin results in decreased expression of EXOC8 protein CTD PMID:32959892 Exoc8 Rat L-methionine multiple interactions ISO Exoc8 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of EXOC8 gene CTD PMID:20938992 Exoc8 Rat manganese atom multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat manganese(0) multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat manganese(II) chloride multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [manganese chloride results in increased abundance of Manganese] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat methylmercury chloride decreases expression ISO EXOC8 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of EXOC8 mRNA CTD PMID:28001369 Exoc8 Rat methylmercury chloride decreases expression EXP 6480464 methylmercuric chloride results in decreased expression of EXOC8 mRNA CTD PMID:30890323 Exoc8 Rat methylmercury chloride multiple interactions EXP 6480464 fisetin inhibits the reaction [methylmercuric chloride results in decreased expression of EXOC8 mRNA] CTD PMID:30890323 Exoc8 Rat N-nitrosodiethylamine increases expression ISO Exoc8 (Mus musculus) 6480464 Diethylnitrosamine results in increased expression of EXOC8 mRNA CTD PMID:17942915 Exoc8 Rat N-nitrosodiethylamine multiple interactions ISO Exoc8 (Mus musculus) 6480464 MET protein inhibits the reaction [Diethylnitrosamine results in increased expression of EXOC8 mRNA] CTD PMID:17942915 Exoc8 Rat paracetamol affects expression ISO Exoc8 (Mus musculus) 6480464 Acetaminophen affects the expression of EXOC8 mRNA CTD PMID:17562736 Exoc8 Rat quercetin decreases expression ISO EXOC8 (Homo sapiens) 6480464 Quercetin results in decreased expression of EXOC8 mRNA CTD PMID:21632981 Exoc8 Rat rac-lactic acid decreases expression ISO EXOC8 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of EXOC8 mRNA CTD PMID:30851411 Exoc8 Rat silicon dioxide decreases expression ISO Exoc8 (Mus musculus) 6480464 Silicon Dioxide results in decreased expression of EXOC8 mRNA CTD PMID:19073995 Exoc8 Rat silver atom increases expression ISO Exoc8 (Mus musculus) 6480464 Silver results in increased expression of EXOC8 mRNA CTD PMID:27131904 Exoc8 Rat silver(0) increases expression ISO Exoc8 (Mus musculus) 6480464 Silver results in increased expression of EXOC8 mRNA CTD PMID:27131904 Exoc8 Rat sodium arsenite increases expression ISO EXOC8 (Homo sapiens) 6480464 sodium arsenite results in increased expression of EXOC8 mRNA CTD PMID:38568856 Exoc8 Rat sodium arsenite multiple interactions ISO EXOC8 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of EXOC8 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of EXOC8 mRNA CTD PMID:39836092 Exoc8 Rat tetrahydropalmatine decreases expression ISO EXOC8 (Homo sapiens) 6480464 tetrahydropalmatine results in decreased expression of EXOC8 protein CTD PMID:20109541 Exoc8 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of EXOC8 mRNA CTD PMID:34492290 Exoc8 Rat thiram increases expression ISO EXOC8 (Homo sapiens) 6480464 Thiram results in increased expression of EXOC8 mRNA CTD PMID:38568856 Exoc8 Rat titanium dioxide decreases methylation ISO Exoc8 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of EXOC8 gene CTD PMID:35295148 Exoc8 Rat titanium dioxide increases methylation ISO Exoc8 (Mus musculus) 6480464 titanium dioxide results in increased methylation of EXOC8 promoter alternative form CTD PMID:35295148 Exoc8 Rat trichostatin A affects expression ISO EXOC8 (Homo sapiens) 6480464 trichostatin A affects the expression of EXOC8 mRNA CTD PMID:28542535 Exoc8 Rat urethane increases expression ISO EXOC8 (Homo sapiens) 6480464 Urethane results in increased expression of EXOC8 mRNA CTD PMID:28818685 Exoc8 Rat valproic acid increases expression ISO EXOC8 (Homo sapiens) 6480464 Valproic Acid results in increased expression of EXOC8 mRNA CTD PMID:29154799 Exoc8 Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of EXOC8 mRNA CTD PMID:23034163
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) aconitine (EXP) aflatoxin B1 (ISO) ammonium chloride (EXP) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) bisphenol F (ISO) cadmium dichloride (ISO) carbon nanotube (ISO) CGP 52608 (ISO) choline (ISO) cyclosporin A (ISO) decabromodiphenyl ether (ISO) dexamethasone (ISO) dibutyl phthalate (ISO) doxorubicin (ISO) epoxiconazole (ISO) fisetin (EXP) folic acid (ISO) formaldehyde (ISO) gentamycin (EXP) indometacin (ISO) ivermectin (ISO) L-methionine (ISO) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methylmercury chloride (EXP,ISO) N-nitrosodiethylamine (ISO) paracetamol (ISO) quercetin (ISO) rac-lactic acid (ISO) silicon dioxide (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (ISO) tetrahydropalmatine (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) trichostatin A (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
3.
Subunit structure of the mammalian exocyst complex.
Kee Y, etal., Proc Natl Acad Sci U S A 1997 Dec 23;94(26):14438-43.
4.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
5.
SH3BP1, an exocyst-associated RhoGAP, inactivates Rac1 at the front to drive cell motility.
Parrini MC, etal., Mol Cell. 2011 Jun 10;42(5):650-61. doi: 10.1016/j.molcel.2011.03.032.
6.
GOA pipeline
RGD automated data pipeline
7.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
8.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
9.
An aPKC-exocyst complex controls paxillin phosphorylation and migration through localised JNK1 activation.
Rosse C, etal., PLoS Biol. 2009 Nov;7(11):e1000235. Epub 2009 Nov 3.
Exoc8 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 69,752,387 - 69,754,876 (-) NCBI GRCr8 mRatBN7.2 19 52,855,010 - 52,857,499 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 52,852,578 - 52,857,491 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 59,639,787 - 59,642,276 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 60,490,839 - 60,493,328 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 62,566,254 - 62,568,743 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 57,647,305 - 57,649,794 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 57,647,291 - 57,649,827 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 68,360,544 - 68,363,033 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 55,066,272 - 55,068,761 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 19 55,071,156 - 55,073,642 (-) NCBI Celera 19 52,222,177 - 52,224,666 (-) NCBI Celera Cytogenetic Map 19 q12 NCBI
EXOC8 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 231,332,753 - 231,337,852 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 231,332,753 - 231,337,852 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 231,468,499 - 231,473,598 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 229,535,103 - 229,540,201 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 227,775,217 - 227,780,313 NCBI Celera 1 204,733,352 - 204,738,448 (-) NCBI Celera Cytogenetic Map 1 q42.2 NCBI HuRef 1 201,951,802 - 201,956,897 (-) NCBI HuRef CHM1_1 1 232,742,131 - 232,747,227 (-) NCBI CHM1_1 T2T-CHM13v2.0 1 230,716,003 - 230,721,102 (-) NCBI T2T-CHM13v2.0
Exoc8 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 125,617,038 - 125,624,444 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 125,619,847 - 125,624,444 (-) Ensembl GRCm39 Ensembl GRCm38 8 124,890,299 - 124,897,705 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 124,893,108 - 124,897,705 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 127,414,199 - 127,421,605 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 127,779,198 - 127,783,795 (-) NCBI MGSCv36 mm8 Celera 8 129,198,972 - 129,206,398 (-) NCBI Celera Cytogenetic Map 8 E2 NCBI cM Map 8 72.82 NCBI
Exoc8 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955492 7,477,015 - 7,479,165 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955492 7,476,866 - 7,481,186 (+) NCBI ChiLan1.0 ChiLan1.0
EXOC8 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 17,866,326 - 17,871,305 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 18,061,958 - 18,070,969 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 206,884,334 - 206,889,753 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 211,908,975 - 211,914,100 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 211,911,802 - 211,913,979 (-) Ensembl panpan1.1 panPan2
EXOC8 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 4 8,133,526 - 8,138,185 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 4 8,133,670 - 8,135,853 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 4 8,125,862 - 8,130,738 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 4 8,158,970 - 8,163,846 (+) NCBI ROS_Cfam_1.0 UMICH_Zoey_3.1 4 8,162,330 - 8,167,207 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 4 8,284,329 - 8,289,206 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 4 8,512,727 - 8,517,604 (+) NCBI UU_Cfam_GSD_1.0
Exoc8 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 43,238,232 - 43,240,797 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936484 19,403,458 - 19,405,197 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936484 19,403,458 - 19,407,202 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
EXOC8 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 59,192,434 - 59,197,542 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 59,192,345 - 59,197,550 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 63,861,048 - 63,866,149 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
EXOC8 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 25 68,594,174 - 68,599,236 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 25 68,596,957 - 68,599,134 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666055 70,502,324 - 70,507,389 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Exoc8
.
Predicted Target Of
Count of predictions: 19 Count of miRNA genes: 16 Interacting mature miRNAs: 19 Transcripts: ENSRNOT00000026757 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
2313395 Anxrr26 Anxiety related response QTL 26 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 19 49976481 53225766 Rat 1578764 Stresp19 Stress response QTL 19 3.6 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 19 15630201 57337602 Rat 61350 Bp32 Blood pressure QTL 32 0.012 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 19 20483575 57337602 Rat 5135224 Leukc1 Leukocyte quantity QTL 1 eosinophil quantity (VT:0002602) blood eosinophil count (CMO:0000033) 19 44340214 55283277 Rat 724546 Kidm3 Kidney mass QTL 3 3.1 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 19 29322490 57337602 Rat 7411549 Bw130 Body weight QTL 130 5 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 19 15455860 57337602 Rat 1358200 Insglur2 Insulin/glucose ratio QTL 2 4.1 blood glucose amount (VT:0000188) serum glucose level (CMO:0000543) 19 33838214 55283146 Rat 724566 Uae12 Urinary albumin excretion QTL 12 5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 2187927 56457239 Rat 1331737 Uae29 Urinary albumin excretion QTL 29 5.5 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 19 4096155 55283277 Rat 2298478 Eau8 Experimental allergic uveoretinitis QTL 8 0.0163 uvea integrity trait (VT:0010551) experimental autoimmune uveitis score (CMO:0001504) 19 17154433 57337602 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000026757 ⟹ ENSRNOP00000026757
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 19 52,852,578 - 52,857,491 (-) Ensembl Rnor_6.0 Ensembl 19 57,647,291 - 57,649,827 (-) Ensembl
RefSeq Acc Id:
NM_139043 ⟹ NP_620612
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 19 69,752,387 - 69,754,876 (-) NCBI mRatBN7.2 19 52,855,010 - 52,857,499 (-) NCBI Rnor_6.0 19 57,647,305 - 57,649,794 (-) NCBI Rnor_5.0 19 68,360,544 - 68,363,033 (-) NCBI RGSC_v3.4 19 55,066,272 - 55,068,761 (-) RGD Celera 19 52,222,177 - 52,224,666 (-) RGD
Sequence:
GGCACGAGGCGCAATGCAGCGCTCGGCCCCGGCGCAGGCGTTTGGGTGTTGCTCCCGCCCCGCTTCCTCTACCGCTTCTCCACCGGGCTCGGGTGGGGCCGGGAGGCGGCGAGTGACAGCCACTGCGG
hide sequence
RefSeq Acc Id:
NP_620612 ⟸ NM_139043
- UniProtKB:
O54924 (UniProtKB/Swiss-Prot), A6KJ24 (UniProtKB/TrEMBL)
- Sequence:
MSDSGASRLRRQLESGGFEARLYVKQLSQQSDGDRDLQEHRQRVQALAEETAQNLKRNVYQNYRQFIETAREISYLESEMYQLSHLLTEQKSSLESIPLALLPAAAAGASTGEDTAGAGPRERGAAQA
hide sequence
Ensembl Acc Id:
ENSRNOP00000026757 ⟸ ENSRNOT00000026757
RGD ID: 13701244 Promoter ID: EPDNEW_R11766 Type: multiple initiation site Name: Exoc8_1 Description: exocyst complex component 8 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 19 57,649,729 - 57,649,789 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-12-06
Exoc8
exocyst complex component 8
Exo84
exocyst complex 84-kDa subunit
Symbol and Name updated
1299863 APPROVED
2002-08-07
Exo84
exocyst complex 84-kDa subunit
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_expression
broadly expressed
69988
gene_protein
84 kDa
69988
