Symbol:
IL6R
Name:
interleukin 6 receptor
RGD ID:
18768490
Description:
ENCODES a protein that exhibits ciliary neurotrophic factor binding (inferred); ciliary neurotrophic factor receptor activity (inferred); cytokine receptor activity (inferred); INVOLVED IN developmental growth (ortholog); negative regulation of collagen biosynthetic process (ortholog); positive regulation of cell population proliferation (ortholog); PARTICIPATES IN interleukin-6 signaling pathway; ASSOCIATED WITH Acute-Phase Reaction (ortholog); Alzheimer's disease (ortholog); arrhythmogenic right ventricular cardiomyopathy (ortholog); FOUND IN extracellular space (ortholog); neuronal cell body membrane (ortholog); plasma membrane (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
interleukin-6 receptor subunit alpha
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 9,345,723 - 9,418,963 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 9,361,152 - 9,396,610 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 8,700,264 - 8,762,770 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - PID (archival)
IL6R Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 9,345,723 - 9,418,963 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 9,361,152 - 9,396,610 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 8,700,264 - 8,762,770 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
IL6R Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 154,405,343 - 154,469,450 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 154,405,193 - 154,469,450 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 154,377,819 - 154,441,926 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 152,644,293 - 152,706,812 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 151,190,741 - 151,253,261 NCBI Celera 1 127,449,298 - 127,511,851 (+) NCBI Celera Cytogenetic Map 1 q21.3 NCBI HuRef 1 125,740,964 - 125,805,584 (+) NCBI HuRef CHM1_1 1 155,774,020 - 155,838,256 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 153,542,427 - 153,606,601 (+) NCBI T2T-CHM13v2.0
Il6ra Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 3 89,776,631 - 89,820,503 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 3 89,771,366 - 89,820,503 (-) Ensembl GRCm39 Ensembl GRCm38 3 89,869,324 - 89,913,196 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 3 89,864,059 - 89,913,196 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 3 89,673,246 - 89,717,084 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 3 89,962,736 - 89,998,969 (-) NCBI MGSCv36 mm8 Celera 3 89,906,161 - 89,949,620 (-) NCBI Celera Cytogenetic Map 3 F1 NCBI cM Map 3 39.19 NCBI
Il6r Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 177,582,020 - 177,646,705 (-) NCBI GRCr8 mRatBN7.2 2 175,289,157 - 175,347,719 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 175,298,686 - 175,347,536 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 182,447,296 - 182,496,140 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 180,469,671 - 180,518,517 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 175,070,810 - 175,119,703 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 189,196,180 - 189,255,987 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 189,205,701 - 189,254,628 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 208,619,391 - 208,679,233 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 182,078,049 - 182,128,135 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 182,028,156 - 182,078,238 (-) NCBI Celera 2 169,240,233 - 169,289,575 (-) NCBI Celera Cytogenetic Map 2 q34 NCBI
Il6r Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955545 950,765 - 981,762 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955545 932,814 - 979,359 (+) NCBI ChiLan1.0 ChiLan1.0
IL6R Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 95,364,609 - 95,427,592 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 95,099,912 - 95,162,870 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 129,761,914 - 129,824,386 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 133,374,078 - 133,433,089 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 133,374,078 - 133,433,089 (+) Ensembl panpan1.1 panPan2
IL6R Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 7 42,877,731 - 42,920,149 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 7 42,880,885 - 42,920,090 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 7 42,368,082 - 42,410,484 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 7 42,747,387 - 42,789,817 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 7 42,747,374 - 42,790,122 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 7 42,526,574 - 42,569,177 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 7 42,580,411 - 42,622,783 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 7 42,864,074 - 42,906,503 (-) NCBI UU_Cfam_GSD_1.0
Il6r Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405058 25,027,301 - 25,051,502 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936580 4,057,771 - 4,081,885 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936580 4,055,438 - 4,081,876 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
IL6R Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 4 95,322,433 - 95,381,282 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 4 95,322,426 - 95,381,393 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 4 104,202,230 - 104,250,108 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Il6r
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000016584 ⟹ ENSCSAP00000016089
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 20 9,361,152 - 9,396,610 (-) Ensembl
RefSeq Acc Id:
XM_007976966 ⟹ XP_007975157
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 20 9,357,052 - 9,418,948 (-) NCBI Vero_WHO_p1.0 NW_023666038 8,700,264 - 8,762,770 (-) NCBI
Sequence:
CCAGGCTACCAAGCACTGCTTTACCATAAGGGTACATCGCCTCCTCGAGGGCTCTCCAGGTGTGCCTTTCACAGCGTAATCCTGTTCACGAAACCAAAAATCAAAACAAGTGCCCTTTTCTCATCAAC
hide sequence
RefSeq Acc Id:
XM_037997867 ⟹ XP_037853795
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source Vero_WHO_p1.0 NW_023666038 8,700,264 - 8,762,770 (-) NCBI
RefSeq Acc Id:
XP_007975157 ⟸ XM_007976966
- Peptide Label:
isoform X1
- UniProtKB:
A0A0D9S5F0 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000016089 ⟸ ENSCSAT00000016584
RefSeq Acc Id:
XP_037853795 ⟸ XM_037997867
- Peptide Label:
isoform X2
- UniProtKB:
A0A0D9S5F0 (UniProtKB/TrEMBL)
