Symbol:
AMBP
Name:
alpha-1-microglobulin/bikunin precursor
RGD ID:
18759420
Description:
ENCODES a protein that exhibits antioxidant activity (ortholog); carbohydrate binding (ortholog); chondroitin sulfate binding (ortholog); INVOLVED IN cellular oxidant detoxification (ortholog); cellular response to reactive oxygen species (ortholog); cytochrome c metabolic process (ortholog); ASSOCIATED WITH acute kidney failure (ortholog); adult respiratory distress syndrome (ortholog); asthma (ortholog); FOUND IN cell surface (ortholog); extracellular space (ortholog); matrix side of mitochondrial inner membrane (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
LOC103218974; protein AMBP
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 12 25,508,516 - 25,526,821 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 12 25,508,682 - 25,527,016 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666035 17,294,343 - 17,312,444 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
AMBP Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 12 25,508,516 - 25,526,821 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 12 25,508,682 - 25,527,016 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666035 17,294,343 - 17,312,444 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
AMBP Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 9 114,060,127 - 114,078,300 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 9 114,060,127 - 114,078,328 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 9 116,822,407 - 116,840,580 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 9 115,862,228 - 115,880,536 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 9 113,901,963 - 113,920,269 NCBI Celera 9 87,469,703 - 87,488,044 (-) NCBI Celera Cytogenetic Map 9 q32 NCBI HuRef 9 86,428,731 - 86,447,071 (-) NCBI HuRef CHM1_1 9 116,968,857 - 116,987,201 (-) NCBI CHM1_1 T2T-CHM13v2.0 9 126,258,798 - 126,276,960 (-) NCBI T2T-CHM13v2.0
Ambp Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 4 63,061,512 - 63,072,409 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 4 63,061,512 - 63,073,036 (-) Ensembl GRCm39 Ensembl GRCm38 4 63,143,275 - 63,154,172 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 4 63,143,275 - 63,154,799 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 4 62,804,313 - 62,815,176 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 4 62,629,640 - 62,640,503 (-) NCBI MGSCv36 mm8 Celera 4 61,799,977 - 61,810,839 (-) NCBI Celera Cytogenetic Map 4 B3 NCBI cM Map 4 33.96 NCBI
Ambp Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 5 81,583,621 - 81,593,938 (-) NCBI GRCr8 mRatBN7.2 5 76,568,094 - 76,578,416 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 5 76,568,094 - 76,578,331 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 5 78,967,475 - 78,977,717 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 5 80,784,609 - 80,794,851 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 5 80,760,118 - 80,770,360 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 5 78,975,690 - 78,986,021 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 5 78,975,678 - 78,985,990 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 5 83,093,799 - 83,104,019 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 5 80,119,742 - 80,129,962 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 5 80,124,854 - 80,135,075 (-) NCBI Celera 5 75,505,542 - 75,515,762 (-) NCBI Celera Cytogenetic Map 5 q24 NCBI
Ambp Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955419 13,478,552 - 13,492,327 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955419 13,478,904 - 13,492,329 (+) NCBI ChiLan1.0 ChiLan1.0
AMBP Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 11 25,296,801 - 25,317,823 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 9 25,299,162 - 25,320,209 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 9 85,157,680 - 85,176,253 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 9 113,525,136 - 113,543,680 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 9 113,525,835 - 113,543,422 (-) Ensembl panpan1.1 panPan2
AMBP Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 11 68,338,644 - 68,353,366 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 11 68,338,389 - 68,351,994 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 11 66,741,500 - 66,756,216 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 11 69,461,851 - 69,476,622 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 11 69,461,782 - 69,475,427 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 11 67,978,768 - 67,993,416 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 11 68,009,752 - 68,024,455 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 11 68,747,753 - 68,762,492 (-) NCBI UU_Cfam_GSD_1.0
Ambp
AMBP Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 254,683,891 - 254,703,225 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 254,683,885 - 254,703,220 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 285,710,963 - 285,725,500 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap 1 q NCBI
Ambp
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000010668 ⟹ ENSCSAP00000008757
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 12 25,508,682 - 25,527,016 (+) Ensembl
RefSeq Acc Id:
XM_007968323 ⟹ XP_007966514
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 12 25,508,516 - 25,526,821 (+) NCBI Vero_WHO_p1.0 NW_023666035 17,294,343 - 17,312,444 (-) NCBI
Sequence:
CTCACAGGGCTGTGAGGTCCAGGTGGTATGACTCAGCAGAAAGGCCAGGTCACTCCCCATCCTCGCATGACCCCAGTGACAGGTAGGGAATCTGAGGGGGACTTTTGGGGGGGCGGAGCCCAACCCTG
hide sequence
RefSeq Acc Id:
XP_007966514 ⟸ XM_007968323
- UniProtKB:
A0A0D9RJG8 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000008757 ⟸ ENSCSAT00000010668
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2022-08-09
AMBP
alpha-1-microglobulin/bikunin precursor
LOC103218974
alpha-1-microglobulin/bikunin precursor
Symbol and/or name change
5135510 APPROVED
2020-12-08
LOC103218974
alpha-1-microglobulin/bikunin precursor
AMBP
alpha-1-microglobulin/bikunin precursor
Symbol and/or name change
5135510 APPROVED
