Advanced Search (OLGA)

Gene: KDSR (3-ketodihydrosphingosine reductase) Chlorocebus sabaeus

Subscribe to Updates

Analyze

Symbol:

KDSR

Name:

3-ketodihydrosphingosine reductase

RGD ID:

18750368

Description:

ENCODES a protein that exhibits 3-dehydrosphinganine reductase activity (inferred); oxidoreductase activity (inferred); INVOLVED IN 3-keto-sphinganine metabolic process (inferred); lipid metabolic process (inferred); sphingolipid biosynthetic process (inferred); PARTICIPATES IN Fabry disease pathway; Gaucher's disease pathway; Krabbe disease pathway; ASSOCIATED WITH chromosome 18q deletion syndrome (ortholog); erythrokeratodermia variabilis et progressiva 4 (ortholog); follicular lymphoma (ortholog); FOUND IN endoplasmic reticulum (inferred); endoplasmic reticulum membrane (inferred)

Type:

protein-coding

RefSeq Status:

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

ChlSab1.1 - Green Monkey 1.1 Assembly

Position:

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	18	16,392,714 - 16,429,912 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	18	16,392,756 - 16,434,035 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666060	9,258,194 - 9,295,466 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	follicular lymphoma		ISO	KDSR (Homo sapiens)	9068941		RGD	PMID:8417785 and REF_RGD_ID:1598985

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	chromosome 18q deletion syndrome		ISO	KDSR (Homo sapiens)	8554872	ClinVar Annotator: match by term: Monosomy 18q and deletion 18q	ClinVar	PMID:25741868 and PMID:31690835
KDSR	Green Monkey	erythrokeratodermia variabilis et progressiva 4		ISO	KDSR (Homo sapiens)	8554872	ClinVar Annotator: match by term: Erythrokeratodermia variabilis et progressiva 4	ClinVar	PMID:25741868 more ...
KDSR	Green Monkey	genetic disease		ISO	KDSR (Homo sapiens)	8554872	ClinVar Annotator: match by term: Inborn genetic diseases	ClinVar	PMID:25741868
KDSR	Green Monkey	multiple congenital anomalies-hypotonia-seizures syndrome 1		ISO	KDSR (Homo sapiens)	8554872	ClinVar Annotator: match by term: Multiple congenital anomalies-hypotonia-seizures syndrome 1	ClinVar	PMID:10677500 more ...

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	follicular lymphoma		ISO	KDSR (Homo sapiens)	9068941	CTD Direct Evidence: marker/mechanism	CTD	PMID:25526675

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	erythrokeratodermia variabilis et progressiva 4		ISO	KDSR (Homo sapiens)	7240710		OMIM

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	3-keto-sphinganine metabolic process	involved_in	IEA	PANTHER:PTN000673044	150520179		TreeGrafter	GO_REF:0000118
KDSR	Green Monkey	3-keto-sphinganine metabolic process	acts_upstream_of_or_within	IEA	UniProtKB:Q06136 and ensembl:ENSP00000494352	150520179		Ensembl	GO_REF:0000107
KDSR	Green Monkey	3-keto-sphinganine metabolic process	involved_in	IEA	InterPro:IPR045022	150520179		InterPro	GO_REF:0000002
KDSR	Green Monkey	lipid metabolic process	involved_in	IEA	UniProtKB-KW:KW-0443	150520179		UniProt	GO_REF:0000043
KDSR	Green Monkey	sphingolipid biosynthetic process	involved_in	IEA	PANTHER:PTN000673044	150520179		TreeGrafter	GO_REF:0000118
KDSR	Green Monkey	sphingolipid biosynthetic process	involved_in	IEA	ARBA:ARBA00027455	150520179		UniProt	GO_REF:0000117
KDSR	Green Monkey	sphingolipid biosynthetic process	acts_upstream_of_or_within	IEA	UniProtKB:Q6GV12 and ensembl:ENSMUSP00000010049	150520179		Ensembl	GO_REF:0000107
KDSR	Green Monkey	sphingolipid biosynthetic process	involved_in	IEA	InterPro:IPR045022	150520179		InterPro	GO_REF:0000002
KDSR	Green Monkey	sphingolipid biosynthetic process	involved_in	IEA	UniProtKB:Q06136 and ensembl:ENSP00000494352	150520179		Ensembl	GO_REF:0000107
KDSR	Green Monkey	sphingolipid metabolic process	involved_in	IEA	UniProtKB-KW:KW-0746	150520179		UniProt	GO_REF:0000043

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	endoplasmic reticulum	located_in	IEA	UniProtKB-KW:KW-0256	150520179		UniProt	GO_REF:0000043
KDSR	Green Monkey	endoplasmic reticulum	located_in	IEA	UniProtKB-SubCell:SL-0095	150520179		UniProt	GO_REF:0000044
KDSR	Green Monkey	endoplasmic reticulum	located_in	IEA	UniProtKB:Q06136 and ensembl:ENSP00000494352	150520179		Ensembl	GO_REF:0000107
KDSR	Green Monkey	endoplasmic reticulum membrane	located_in	IEA	PANTHER:PTN000673044	150520179		TreeGrafter	GO_REF:0000118

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	3-dehydrosphinganine reductase activity	enables	IEA	PANTHER:PTN000673044	150520179		TreeGrafter	GO_REF:0000118
KDSR	Green Monkey	3-dehydrosphinganine reductase activity	enables	IEA	InterPro:IPR045022	150520179		InterPro	GO_REF:0000002
KDSR	Green Monkey	3-dehydrosphinganine reductase activity	enables	IEA	UniProtKB:Q06136 and ensembl:ENSP00000494352	150520179		Ensembl	GO_REF:0000107
KDSR	Green Monkey	oxidoreductase activity	enables	IEA	InterPro:IPR020904	150520179		InterPro	GO_REF:0000002
KDSR	Green Monkey	oxidoreductase activity	enables	IEA	UniProtKB-KW:KW-0560	150520179		UniProt	GO_REF:0000043
KDSR	Green Monkey	protein binding	enables	ISO	UniProtKB:O60333-2 more ...	9068941	PMID:32814053	IntAct	PMID:32814053

Imported Annotations - SMPDB

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
KDSR	Green Monkey	Fabry disease pathway		ISO	KDSR (Homo sapiens)	9068941		SMPDB	SMP:00525
KDSR	Green Monkey	Gaucher's disease pathway		ISO	KDSR (Homo sapiens)	9068941		SMPDB	SMP:00349
KDSR	Green Monkey	Krabbe disease pathway		ISO	KDSR (Homo sapiens)	9068941		SMPDB	SMP:00348
KDSR	Green Monkey	metachromatic leukodystrophy pathway		ISO	KDSR (Homo sapiens)	9068941		SMPDB	SMP:00347
KDSR	Green Monkey	sphingolipid metabolic pathway		ISO	KDSR (Homo sapiens)	9068941		SMPDB	SMP:00034

PMID:22301074	PMID:30032202

KDSR
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	18	16,392,714 - 16,429,912 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	18	16,392,756 - 16,434,035 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666060	9,258,194 - 9,295,466 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

KDSR
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	18	63,327,726 - 63,367,206 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	18	63,327,726 - 63,367,228 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	18	60,994,959 - 61,034,439 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	18	59,145,951 - 59,185,486 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	18	59,148,812 - 59,185,438	NCBI
Celera	18	57,714,472 - 57,754,142 (-)	NCBI		Celera
Cytogenetic Map	18	q21.33	NCBI
HuRef	18	57,693,465 - 57,733,080 (-)	NCBI		HuRef
CHM1_1	18	60,990,909 - 61,030,493 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	18	63,532,776 - 63,572,250 (-)	NCBI		T2T-CHM13v2.0

Kdsr
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	1	106,648,140 - 106,689,544 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	1	106,648,189 - 106,687,457 (-)	Ensembl		GRCm39 Ensembl
GRCm38	1	106,720,410 - 106,759,742 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	1	106,720,459 - 106,759,727 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	1	108,616,987 - 108,656,319 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	1	108,551,436 - 108,587,347 (-)	NCBI		MGSCv36	mm8
Celera	1	109,569,745 - 109,609,088 (-)	NCBI		Celera
Cytogenetic Map	1	E2.1	NCBI
cM Map	1	49.99	NCBI

Kdsr
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	13	23,374,101 - 23,408,779 (-)	NCBI		GRCr8
mRatBN7.2	13	22,862,117 - 22,894,118 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	13	22,862,117 - 22,894,108 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	13	23,184,947 - 23,216,962 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	13	24,469,418 - 24,501,431 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	13	23,155,132 - 23,187,149 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	13	26,779,386 - 26,812,271 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	13	26,780,633 - 26,812,215 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	13	31,929,862 - 31,962,754 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	13	12,914,967 - 12,946,853 (-)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
RGSC_v3.1	13	12,914,896 - 12,946,797 (-)	NCBI
Celera	13	22,721,005 - 22,752,490 (-)	NCBI		Celera
Cytogenetic Map	13	p11	NCBI

Kdsr
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955402	47,092,779 - 47,130,132 (-)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955402	47,092,779 - 47,130,131 (-)	NCBI	ChiLan1.0	ChiLan1.0

KDSR
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	17	80,840,824 - 80,878,698 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	18	66,530,449 - 66,571,494 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	18	56,686,914 - 56,727,681 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	18	60,003,576 - 60,040,365 (-)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	18	60,001,637 - 60,036,292 (-)	Ensembl	panpan1.1		panPan2

KDSR
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	13,682,838 - 13,726,872 (+)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	13,689,246 - 13,723,528 (+)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	14,654,928 - 14,692,956 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	13,550,434 - 13,588,484 (+)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	1	13,550,483 - 13,585,739 (+)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	1	13,588,547 - 13,626,566 (+)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	13,517,813 - 13,555,882 (+)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	13,766,595 - 13,804,675 (+)	NCBI		UU_Cfam_GSD_1.0

Kdsr
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024404944	26,931,216 - 26,960,699 (+)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936497	2,169,712 - 2,203,150 (+)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936497	2,169,982 - 2,199,600 (+)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

KDSR
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	1	158,288,544 - 158,329,881 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	1	158,288,544 - 158,329,898 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	1	175,775,310 - 175,822,928 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Kdsr
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624792	9,040,999 - 9,082,154 (-)	Ensembl	HetGla_female_1.0	HetGla_female_1.0 Ensembl	hetGla2
HetGla 1.0	NW_004624792	9,038,076 - 9,081,650 (-)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

Variants in KDSR
1113 total Variants

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

ectoderm	endocrine system	hemolymphoid system	mesenchyme	mesoderm	nervous system	reproductive system
76	36	20	36	36	60	20


RefSeq Transcripts	XM_008013865	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	XM_008013866	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JACDXN010000028	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSCSAT00000016289 ⟹ ENSCSAP00000014208

Type:

CODING

Position:

Green Monkey Assembly	Chr	Position (strand)	Source
ChlSab1.1 Ensembl	18	16,392,756 - 16,434,035 (+)	Ensembl

RefSeq Acc Id:

XM_008013865 ⟹ XP_008012056

Type:

CODING

Position:

Green Monkey Assembly	Chr	Position (strand)	Source
ChlSab1.1	18	16,392,714 - 16,429,912 (+)	NCBI
Vero_WHO_p1.0	NW_023666060	9,258,194 - 9,295,466 (-)	NCBI

Sequence:

show sequence

TTCGCCGCCGCCCAGCCTTGCGCGCCCCGCCTGGCGCCCCCCGCCCGGCCGCGCCGGGCCCCTGGCCCCGCGGAGCGATGCTGCTGCTGGCTGCCGCCTTTCTCGTGGCCTTCGTGCTGCTGCTCTAC
ATGGTGTCTCCGCTCATCAGCCCCAAGCCCCTCGCCCTGCCCGGGGCGCATGTGGTGGTTACAGGAGGTTCCAGTGGCATCGGGAAGTGCATTGCCATTGAGTGCTATAAACAAGGAGCCTTTATAAC
TCTGGTTGCACGAAATGAGGATAAGCTGCTGCAAGCAAAGAAAGAAATTGAAATGCACTCTATTAATGATAAACAGGTGGTGCTTTGCATATCGGTTGACGTATCTCAAGACTATAACCAAGTAGAGA
ATGTCATAAAACAAGCACAGGAGAAACTGGGTCCAGTGGACATGCTTGTAAATTGTGCAGGAATGGCGATGTCAGGAAAATTTGAAGATCTTGAAGTTAGTACCTTTGAAAGGTTAATGAGCATCAAT
TACCTGGGCAGCGTGTACCCCAGCCGGGCCGTGATCACCACCATGAAGGAGCGCCGGGTGGGCAGGATCGTGTTTGTGTCCTCCCAGGCAGGACAGTTGGGATTATTCGGTTTCACAGCCTACTCTGC
ATCCAAGTTTGCCATAAGGGGATTGGCAGAAGCTTTGCAGATGGAGGTGAAGCCATATAATGTCTACATCACAGTTGCTTACCCACCAGACACAGATACACCTGGCTTTGCCGAAGAAAACAGAACAA
AGCCTTTGGAGACTCGACTTATTTCAGAGACCACATCTGTGTGCAAACCAGAACAGGTGGCCAAACAAATTGTTAAAGATGCCATACAAGGAAATTTCAACAGTTCCCTTGGCTCCGATGGGTACATG
CTCTCGGCCCTGACCTGTGGGATGGCTCCAGTAACTTCTATTACTGAGGGGCTCCAGCAGGTGGTCACCATGGGCCTGTTCCGCACTATTGCTTTGTTTTACCTTGGAAGTTTTGACAGCATAGTTCG
TCGCTGCATGATGCAGAGAGAAAAATCTGAAATTGCAGACAAAACTGCCTAATTCTTCTCACCCTTTGGAAGAAGACTGTTTCCAAATAATTTGAACAGCTTGCTGCTAAATGGGACCCAATTTTTGG
CCTATAGACACTTATATATTGTTTTCAAATGTGTCAGATTGGACCAGTGCTCTTCAGAAATGTGGCTGCAAGCAAGGGGCTAGAAGTCCACCTCCTGACAATATTATTAATACTATGCAAATATGGAA
TAGGAGACCATTTGATTTTCTAGGCTTTGAGGTAGAGAAGTGAAGGTATGAGAATTAATACCATGTGAACAAGG

hide sequence


Protein RefSeqs	XP_008012056	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSCSAP00000014208
	ENSCSAP00000014208.1

RefSeq Acc Id:	XP_008012056 ⟸ XM_008013865
- UniProtKB:	A0A0D9S019 (UniProtKB/TrEMBL)

Ensembl Acc Id:

ENSCSAP00000014208 ⟸ ENSCSAT00000016289

Database	Acc Id	Source(s)
Ensembl Genes	ENSCSAG00000018193	Ensembl, ENTREZGENE, UniProtKB/TrEMBL
Ensembl Transcript	ENSCSAT00000016289.1	UniProtKB/TrEMBL
Gene3D-CATH	NAD(P)-binding Rossmann-like Domain	UniProtKB/TrEMBL
InterPro	KDSR-like	UniProtKB/TrEMBL
	NAD(P)-bd_dom_sf	UniProtKB/TrEMBL
	Sc_DH/Rdtase_CS	UniProtKB/TrEMBL
	SDR_fam	UniProtKB/TrEMBL
KEGG Report	csab:103244164	UniProtKB/TrEMBL
NCBI Gene	KDSR	ENTREZGENE
PANTHER	3-KETODIHYDROSPHINGOSINE REDUCTASE	UniProtKB/TrEMBL
	3-KETODIHYDROSPHINGOSINE REDUCTASE	UniProtKB/TrEMBL
Pfam	adh_short	UniProtKB/TrEMBL
PRINTS	GDHRDH	UniProtKB/TrEMBL
	SDRFAMILY	UniProtKB/TrEMBL
PROSITE	ADH_SHORT	UniProtKB/TrEMBL
Superfamily-SCOP	SSF51735	UniProtKB/TrEMBL
UniProt	A0A0D9S019	ENTREZGENE, UniProtKB/TrEMBL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Imported Disease Annotations - OMIM

Imported Annotations - SMPDB

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Imported Disease Annotations - OMIM

Imported Annotations - SMPDB