Symbol:
SERPINA1
Name:
serpin family A member 1
RGD ID:
18571751
Description:
ENCODES a protein that exhibits endopeptidase inhibitor activity (ortholog); serine-type endopeptidase inhibitor activity (ortholog); INVOLVED IN negative regulation of serine-type endopeptidase activity (ortholog); response to chromate (ortholog); response to cytokine (ortholog); PARTICIPATES IN forkhead class A signaling pathway; ASSOCIATED WITH achondrogenesis type IA (ortholog); acute kidney failure (ortholog); acute pancreatitis (ortholog); FOUND IN extracellular space (ortholog)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
alpha-1-antitrypsin
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 24 72,158,521 - 72,171,139 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 24 72,156,784 - 72,163,500 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666053 59,387,764 - 59,400,148 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - PID (archival)
SERPINA1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 24 72,158,521 - 72,171,139 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 24 72,156,784 - 72,163,500 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666053 59,387,764 - 59,400,148 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
SERPINA1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 14 94,376,747 - 94,390,635 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 14 94,376,747 - 94,390,693 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 14 94,843,084 - 94,856,972 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 14 93,914,451 - 93,926,782 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 14 93,914,450 - 93,926,782 NCBI Celera 14 74,898,987 - 74,912,932 (-) NCBI Celera Cytogenetic Map 14 q32.13 NCBI HuRef 14 75,022,652 - 75,036,601 (-) NCBI HuRef CHM1_1 14 94,780,885 - 94,794,830 (-) NCBI CHM1_1 T2T-CHM13v2.0 14 88,606,265 - 88,620,155 (-) NCBI T2T-CHM13v2.0
Serpina1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 6 128,631,101 - 128,653,125 (-) NCBI GRCr8 mRatBN7.2 6 122,866,314 - 122,888,339 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 6 122,866,312 - 122,888,339 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 6 123,007,214 - 123,029,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 6 123,302,499 - 123,324,535 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 6 122,639,411 - 122,661,452 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 6 127,610,241 - 127,632,265 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 6 127,610,243 - 127,632,265 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 6 136,828,856 - 136,850,880 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 6 127,998,617 - 128,021,719 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 6 128,002,364 - 128,025,466 (-) NCBI Celera 6 120,346,394 - 120,368,519 (-) NCBI Celera Cytogenetic Map 6 q32 NCBI
LOC102021597 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955438 17,920,200 - 17,929,105 (+) NCBI ChiLan1.0 ChiLan1.0
SERPINA1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 15 95,525,119 - 95,539,108 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 14 94,741,624 - 94,755,614 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 14 75,001,714 - 75,014,214 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 14 94,334,258 - 94,347,085 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 14 94,334,258 - 94,345,419 (-) Ensembl panpan1.1 panPan2
SERPINA1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 8 63,388,498 - 63,400,377 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 8 63,376,945 - 63,398,435 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 8 62,965,044 - 62,974,971 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 8 63,654,807 - 63,666,723 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 8 63,654,816 - 63,664,785 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 8 63,330,666 - 63,340,582 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 8 63,382,963 - 63,392,890 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 8 63,713,659 - 63,723,574 (-) NCBI UU_Cfam_GSD_1.0
SERPINA1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 115,583,043 - 115,614,645 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 115,604,282 - 115,616,915 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 122,616,080 - 122,628,726 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3 Pig Cytomap 7 q24-q26 NCBI
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000009011 ⟹ ENSCSAP00000007144
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 24 72,156,784 - 72,163,500 (-) Ensembl
RefSeq Acc Id:
XM_007987698 ⟹ XP_007985889
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 24 72,158,558 - 72,171,137 (-) NCBI Vero_WHO_p1.0 NW_023666053 59,387,764 - 59,400,148 (-) NCBI
Sequence:
CGCCACCCGAGGCCGACTTCCTGGGTGGGCAGGAACTGGGCCCTGTGCCCAGGGCGTGCACTGCCTCCACGCAGCAACCCTCAGAGTACTGAGCTGAGCCAAGAAGGAAGAGGGGATCAGCACTCTGA
hide sequence
RefSeq Acc Id:
XM_007987699 ⟹ XP_007985890
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 24 72,158,521 - 72,169,067 (-) NCBI Vero_WHO_p1.0 NW_023666053 59,387,764 - 59,398,967 (-) NCBI
Sequence:
GCCAGGTACAATGACTCCTTTTGGTACGTGCAGTGGAGGCTGTACACTGCTCAGGCAGAGCGTCCGGACAGCGTGGGCGGGCGACTCAGAGCCCAGCCTGTGAACTTAGTCCCTGTTTGCTCCTCCGG
hide sequence
RefSeq Acc Id:
XP_007985890 ⟸ XM_007987699
- UniProtKB:
A0A0D9REV5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_007985889 ⟸ XM_007987698
- UniProtKB:
A0A0D9REV5 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000007144 ⟸ ENSCSAT00000009011
