Symbol:
IL23R
Name:
interleukin 23 receptor
RGD ID:
18417692
Description:
ENCODES a protein that exhibits cytokine receptor activity (inferred); interleukin-12 receptor binding (inferred); interleukin-23 binding (inferred); INVOLVED IN interleukin-23-mediated signaling pathway (inferred); negative regulation of interleukin-10 production (inferred); positive regulation of defense response to virus by host (inferred); PARTICIPATES IN interleukin-23 signaling pathway; ASSOCIATED WITH ankylosing spondylitis (ortholog); arthritis (ortholog); asthma (ortholog); FOUND IN cell surface (inferred); interleukin-23 receptor complex (inferred); membrane (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
interleukin-23 receptor
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 65,853,379 - 65,946,000 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 65,854,349 - 65,938,024 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666033 51,655,750 - 51,751,460 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Imported Annotations - PID (archival)
IL23R Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 65,853,379 - 65,946,000 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 65,854,349 - 65,938,024 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666033 51,655,750 - 51,751,460 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
IL23R Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 67,138,637 - 67,265,903 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 67,138,907 - 67,259,979 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 67,632,137 - 67,725,662 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 67,404,757 - 67,498,250 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 67,344,189 - 67,437,669 NCBI Celera 1 65,922,104 - 66,015,428 (+) NCBI Celera Cytogenetic Map 1 p31.3 NCBI HuRef 1 65,740,552 - 65,835,548 (+) NCBI HuRef CHM1_1 1 67,747,479 - 67,841,006 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 67,016,149 - 67,143,448 (+) NCBI T2T-CHM13v2.0
Il23r Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 67,399,906 - 67,468,838 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 67,399,916 - 67,468,839 (-) Ensembl GRCm39 Ensembl GRCm38 6 67,422,932 - 67,491,855 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 67,422,932 - 67,491,855 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 67,372,926 - 67,441,849 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 67,352,510 - 67,421,433 (-) NCBI MGSCv36 mm8 Celera 6 69,541,500 - 69,610,484 (-) NCBI Celera Cytogenetic Map 6 C1 NCBI cM Map 6 30.85 NCBI
Il23r Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 97,910,230 - 98,003,759 (-) NCBI GRCr8 mRatBN7.2 4 96,580,568 - 96,672,540 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 96,580,714 - 96,674,021 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 4 98,203,788 - 98,306,729 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 98,203,958 - 98,305,173 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 162,989,461 - 163,092,313 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Rnor_5.0 4 163,191,096 - 163,200,531 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 97,087,580 - 97,768,978 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 4 91,260,435 - 91,346,771 (-) NCBI Celera Cytogenetic Map 4 q31 NCBI
Il23r Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955423 23,842,475 - 23,884,904 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955423 23,841,342 - 23,885,191 (-) NCBI ChiLan1.0 ChiLan1.0
IL23R Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 159,561,801 - 159,727,876 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 158,721,629 - 158,887,710 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 66,408,839 - 66,502,535 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 68,293,514 - 68,386,815 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 68,293,514 - 68,386,815 (+) Ensembl panpan1.1 panPan2
IL23R Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 43,307,422 - 43,369,806 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 43,308,982 - 43,368,474 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 43,492,672 - 43,558,098 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 43,489,715 - 43,555,184 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 43,494,316 - 43,555,221 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 43,455,682 - 43,521,106 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 43,402,563 - 43,468,018 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 43,641,801 - 43,707,245 (-) NCBI UU_Cfam_GSD_1.0
Il23r Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405058 80,065,633 - 80,123,951 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936591 4,365,762 - 4,425,005 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936591 4,365,598 - 4,425,053 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
IL23R Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 145,335,741 - 145,401,510 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 145,337,765 - 145,401,909 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 134,219,683 - 134,283,706 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Il23r
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000017170 ⟹ ENSCSAP00000016654
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 20 65,854,349 - 65,938,024 (-) Ensembl
RefSeq Acc Id:
XM_007978367 ⟹ XP_007976558
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 20 65,853,379 - 65,940,070 (-) NCBI Vero_WHO_p1.0 NW_023666033 51,655,750 - 51,751,460 (+) NCBI
Sequence:
TCATCAATTATACTTCAACAAAGCTGGAAAACTAAAAAAAGAAACAAGTGTATAATTAATAACAATGCTGGTTGTAAATTAAAACTAAGCGCCATATTTTTGGTGTCAAAATGTTTGACGTTTTTAAG
hide sequence
RefSeq Acc Id:
XP_007976558 ⟸ XM_007978367
- UniProtKB:
A0A0D9S715 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000016654 ⟸ ENSCSAT00000017170
