Symbol:
KLF2
Name:
KLF transcription factor 2
RGD ID:
18407882
Description:
ENCODES a protein that exhibits DNA binding (inferred); DNA-binding transcription factor activity (inferred); DNA-binding transcription factor activity, RNA polymerase II-specific (inferred); INVOLVED IN cellular response to endothelin (ortholog); cellular response to hydrogen peroxide (ortholog); cellular response to interleukin-1 (ortholog); ASSOCIATED WITH Colorectal Neoplasms (ortholog); COVID-19 (ortholog); lung disease (ortholog); FOUND IN chromatin (inferred); nucleus (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
Krueppel-like factor 2; Kruppel like factor 2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 14,832,013 - 14,834,744 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 14,832,029 - 14,837,462 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666074 4,637,274 - 4,640,383 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
KLF2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 6 14,832,013 - 14,834,744 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 6 14,832,029 - 14,837,462 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666074 4,637,274 - 4,640,383 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
KLF2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 19 16,324,826 - 16,328,685 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 19 16,324,826 - 16,328,685 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 19 16,435,637 - 16,439,496 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 19 16,296,651 - 16,299,345 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 19 16,296,650 - 16,299,337 NCBI Celera 19 16,337,566 - 16,340,260 (+) NCBI Celera Cytogenetic Map 19 p13.11 NCBI HuRef 19 16,006,724 - 16,007,405 (+) NCBI HuRef CHM1_1 19 16,435,181 - 16,437,875 (+) NCBI CHM1_1 T2T-CHM13v2.0 19 16,459,702 - 16,463,562 (+) NCBI T2T-CHM13v2.0
Klf2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 73,072,906 - 73,075,498 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 73,072,877 - 73,075,500 (+) Ensembl GRCm39 Ensembl GRCm38 8 72,319,062 - 72,321,654 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 72,319,033 - 72,321,656 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 74,842,961 - 74,845,553 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 75,248,022 - 75,250,338 (+) NCBI MGSCv36 mm8 Celera 8 76,656,424 - 76,659,017 (+) NCBI Celera Cytogenetic Map 8 B3.3 NCBI cM Map 8 34.99 NCBI
Klf2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 17,555,136 - 17,557,768 (-) NCBI GRCr8 mRatBN7.2 16 17,521,107 - 17,523,739 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 17,514,552 - 17,523,944 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 17,587,223 - 17,589,173 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 18,720,530 - 18,722,483 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 17,640,143 - 17,642,093 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 19,223,087 - 19,225,037 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 19,223,087 - 19,225,037 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 19,084,196 - 19,086,146 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 17,941,780 - 17,943,730 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 17,941,777 - 17,943,728 (-) NCBI Celera 16 17,739,313 - 17,741,263 (-) NCBI Celera Cytogenetic Map 16 p14 NCBI
KLF2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 20 21,194,451 - 21,197,283 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 19 20,200,667 - 20,203,238 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 19 15,812,506 - 15,815,244 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 19 16,792,497 - 16,794,143 (+) NCBI panpan1.1 PanPan1.1 panPan2
KLF2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 20 46,182,565 - 46,183,704 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 20 46,096,492 - 46,098,925 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 20 46,670,279 - 46,672,712 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 20 46,670,789 - 46,672,713 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 20 45,904,933 - 45,907,365 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 20 46,316,205 - 46,318,628 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 20 46,591,720 - 46,594,153 (-) NCBI UU_Cfam_GSD_1.0
KLF2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 61,270,199 - 61,273,138 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 61,270,733 - 61,273,037 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 60,903,997 - 60,904,625 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Klf2
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000003798 ⟹ ENSCSAP00000002072
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 6 14,832,029 - 14,837,462 (+) Ensembl
RefSeq Acc Id:
XM_007995639 ⟹ XP_007993830
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 6 14,832,013 - 14,834,744 (+) NCBI Vero_WHO_p1.0 NW_023666074 4,637,274 - 4,640,383 (-) NCBI
Sequence:
CCCACAGAGCCGTCCCCGCCCGCCCGCGCCCCGACCAGCCCGGCCTCGGGCAGCCACTCACCGGTGTCCCCCGTCCGCGTCCTTCCTCCCCGGGTCCCAGCCATGGCGCTGAGTGAACCCATCCTGCC
hide sequence
RefSeq Acc Id:
XP_007993830 ⟸ XM_007995639
- UniProtKB:
A0A0D9R0D3 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000002072 ⟸ ENSCSAT00000003798
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2022-07-12
KLF2
KLF transcription factor 2
KLF2
Kruppel like factor 2
Symbol and/or name change
5135510 APPROVED
