Symbol:
ARL2BP
Name:
ARF like GTPase 2 binding protein (Ensembl:ADP ribosylation factor like GTPase 2 binding protein)
RGD ID:
18349394
Description:
ENCODES a protein that exhibits transcription coactivator activity (inferred); INVOLVED IN positive regulation of tyrosine phosphorylation of STAT protein (ortholog); ASSOCIATED WITH Bardet-Biedl syndrome (ortholog); Chromosome 16q12 Duplication Syndrome (ortholog); developmental and epileptic encephalopathy (ortholog); FOUND IN cell projection (inferred); centrosome (inferred); ciliary basal body (inferred)
Type:
protein-coding
RefSeq Status:
MODEL
Previously known as:
ADP-ribosylation factor-like protein 2-binding protein; LOC103233055
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
ChlSab1.1 - Green Monkey 1.1 Assembly
Position:
Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 5 43,192,283 - 43,200,113 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 5 43,192,287 - 43,201,681 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666047 33,118,182 - 33,127,306 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
ARL2BP Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 5 43,192,283 - 43,200,113 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 5 43,192,287 - 43,201,681 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666047 33,118,182 - 33,127,306 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
ARL2BP Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 16 57,245,259 - 57,253,635 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 16 57,245,259 - 57,253,635 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 16 57,279,171 - 57,287,547 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 16 55,836,539 - 55,845,046 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 16 55,836,538 - 55,845,046 NCBI Celera 16 41,778,726 - 41,787,233 (+) NCBI Celera Cytogenetic Map 16 q13 NCBI HuRef 16 43,148,688 - 43,157,185 (+) NCBI HuRef CHM1_1 16 58,687,284 - 58,695,791 (+) NCBI CHM1_1 T2T-CHM13v2.0 16 63,041,248 - 63,049,621 (+) NCBI T2T-CHM13v2.0
Arl2bp Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 95,393,228 - 95,401,085 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 95,393,228 - 95,401,053 (+) Ensembl GRCm39 Ensembl GRCm38 8 94,666,600 - 94,674,457 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 94,666,600 - 94,674,425 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 97,190,655 - 97,198,322 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 97,555,884 - 97,563,551 (+) NCBI MGSCv36 mm8 Celera 8 98,995,245 - 99,002,895 (+) NCBI Celera Cytogenetic Map 8 C5 NCBI cM Map 8 46.65 NCBI
Arl2bp Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 19 10,342,895 - 10,352,529 (-) NCBI GRCr8 mRatBN7.2 19 10,336,921 - 10,346,555 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 19 10,336,921 - 10,346,564 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 19 10,300,195 - 10,309,713 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 19 11,067,044 - 11,076,562 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 19 10,353,992 - 10,363,509 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 19 10,753,670 - 10,763,247 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 19 10,753,681 - 10,763,110 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 19 10,747,782 - 10,757,507 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 19 10,777,163 - 10,786,698 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 19 10,226,305 - 10,235,761 (-) NCBI Celera Cytogenetic Map 19 p13 NCBI
Arl2bp Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955433 14,887,094 - 14,894,119 (+) NCBI ChiLan1.0 ChiLan1.0
ARL2BP Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 18 66,714,280 - 66,722,836 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 16 72,635,053 - 72,643,602 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 16 37,520,140 - 37,528,634 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 16 56,653,883 - 56,661,404 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 16 56,653,742 - 56,661,404 (+) Ensembl panpan1.1 panPan2
ARL2BP Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 2 59,127,139 - 59,133,993 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 2 59,128,323 - 59,133,902 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 2 55,754,660 - 55,762,075 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 2 59,664,788 - 59,672,205 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 2 59,665,634 - 59,672,310 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 2 56,496,410 - 56,503,621 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 2 57,503,458 - 57,510,873 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 2 58,397,522 - 58,404,950 (-) NCBI UU_Cfam_GSD_1.0
Arl2bp Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409349 50,236,986 - 50,245,702 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936475 9,343,336 - 9,352,065 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936475 9,343,333 - 9,352,089 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ARL2BP Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 6 19,207,071 - 19,223,194 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 6 19,207,013 - 19,215,014 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 6 17,197,974 - 17,205,969 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
Arl2bp
.
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSCSAT00000002958 ⟹ ENSCSAP00000001250
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 Ensembl 5 43,192,287 - 43,201,681 (+) Ensembl
RefSeq Acc Id:
XM_007993429 ⟹ XP_007991620
Type:
CODING
Position:
Green Monkey Assembly Chr Position (strand) Source ChlSab1.1 5 43,192,283 - 43,200,113 (+) NCBI Vero_WHO_p1.0 NW_023666047 33,118,182 - 33,127,306 (-) NCBI
Sequence:
GGGGCGGCAGTCACCTAGGCCTGGACCTGCGGCGTCGGCTGCGCGCGCAGAGGGCCCGGCGGGGCGTAGAGGCCGGGCTGACGAGTGGACGCTGCGGGTATCCAAGGCGGGGCCTGGCGCGCAGGCGC
hide sequence
RefSeq Acc Id:
XP_007991620 ⟸ XM_007993429
- UniProtKB:
A0A0D9QY11 (UniProtKB/TrEMBL)
Ensembl Acc Id:
ENSCSAP00000001250 ⟸ ENSCSAT00000002958
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2024-09-25
ARL2BP
ARF like GTPase 2 binding protein
ARL2BP
ADP ribosylation factor like GTPase 2 binding protein
Symbol and/or name change
5135510 APPROVED
2022-08-09
ARL2BP
ADP ribosylation factor like GTPase 2 binding protein
LOC103233055
ADP ribosylation factor like GTPase 2 binding protein
Symbol and/or name change
5135510 APPROVED
2020-12-08
LOC103233055
ADP ribosylation factor like GTPase 2 binding protein
ARL2BP
ADP ribosylation factor like GTPase 2 binding protein
Symbol and/or name change
5135510 APPROVED
