Symbol:
Tgfbrap1
Name:
transforming growth factor, beta receptor associated protein 1
RGD ID:
1621492
MGI Page
MGI
Description:
Predicted to enable SMAD binding activity and transforming growth factor beta receptor binding activity. Predicted to be involved in several processes, including endosomal vesicle fusion; endosome to lysosome transport; and regulation of DNA-templated transcription. Part of CORVET complex. Is expressed in several structures, including gonad; gut; hemolymphoid system; liver; and lung. Orthologous to human TGFBRAP1 (transforming growth factor beta receptor associated protein 1).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
3110018K12Rik; AU024090; AU042859; AW742551; tansforming growth factor, beta receptor associated protein 1; TGF beta receptor associated protein 1; TGF-beta receptor-associated protein 1; transforming growth factor-beta receptor-associated protein 1; TRAP-1; Trap1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Tgfbrap1 (transforming growth factor, beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tgfbrap1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tgfbrap1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tgfbrap1 (transforming growth factor beta receptor associated protein 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Tgfbrap1 (transforming growth factor, beta receptor associated protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
TGFBRAP1 (transforming growth factor beta receptor associated protein 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tgfbrap1 (transforming growth factor, beta receptor associated protein 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
VAM6
Alliance
DIOPT (OrthoFinder|OrthoInspector|PANTHER)
Xenopus tropicalis (tropical clawed frog):
tgfbrap1
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 43,086,360 - 43,137,788 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 43,086,360 - 43,137,797 (-) Ensembl GRCm39 Ensembl GRCm38 1 43,047,200 - 43,098,712 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 43,047,200 - 43,098,637 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 43,104,114 - 43,155,467 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 42,991,815 - 43,043,168 (-) NCBI MGSCv36 mm8 Celera 1 43,385,583 - 43,437,075 (-) NCBI Celera Cytogenetic Map 1 B NCBI cM Map 1 22.13 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tgfbrap1 Mouse 1,2-dimethylhydrazine increases expression EXP 6480464 1 and 2-Dimethylhydrazine results in increased expression of TGFBRAP1 mRNA CTD PMID:22206623 Tgfbrap1 Mouse 17beta-estradiol affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 Estradiol affects the expression of TGFBRAP1 mRNA CTD PMID:21826169 Tgfbrap1 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TGFBRAP1 mRNA CTD PMID:39298647 Tgfbrap1 Mouse 17beta-estradiol increases expression ISO TGFBRAP1 (Homo sapiens) 6480464 Estradiol results in increased expression of TGFBRAP1 mRNA CTD PMID:23019147 Tgfbrap1 Mouse 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tgfbrap1 Mouse 2,2',5,5'-tetrachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tgfbrap1 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of TGFBRAP1 mRNA CTD PMID:21570461 Tgfbrap1 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Tgfbrap1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of TGFBRAP1 mRNA CTD PMID:33387578 Tgfbrap1 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Tgfbrap1 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin affects the expression of TGFBRAP1 mRNA CTD PMID:22298810 Tgfbrap1 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin affects the expression of TGFBRAP1 mRNA CTD PMID:22574217 Tgfbrap1 Mouse aflatoxin B1 increases expression ISO TGFBRAP1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of TGFBRAP1 mRNA CTD PMID:22100608 Tgfbrap1 Mouse aflatoxin B1 increases methylation ISO TGFBRAP1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of TGFBRAP1 intron CTD PMID:30157460 Tgfbrap1 Mouse aflatoxin B1 decreases methylation ISO TGFBRAP1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of TGFBRAP1 gene CTD PMID:27153756 Tgfbrap1 Mouse all-trans-retinoic acid decreases expression ISO TGFBRAP1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of TGFBRAP1 mRNA CTD PMID:33167477 Tgfbrap1 Mouse arsenite(3-) multiple interactions ISO TGFBRAP1 (Homo sapiens) 6480464 arsenite inhibits the reaction [G3BP1 protein binds to TGFBRAP1 mRNA] CTD PMID:32406909 Tgfbrap1 Mouse atrazine decreases expression ISO TGFBRAP1 (Homo sapiens) 6480464 Atrazine results in decreased expression of TGFBRAP1 mRNA CTD PMID:22378314 Tgfbrap1 Mouse atrazine affects methylation ISO Tgfbrap1 (Rattus norvegicus) 6480464 Atrazine affects the methylation of TGFBRAP1 gene CTD PMID:28931070 Tgfbrap1 Mouse benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of TGFBRAP1 mRNA CTD PMID:22228805 Tgfbrap1 Mouse benzo[a]pyrene diol epoxide I decreases expression ISO TGFBRAP1 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Tgfbrap1 Mouse benzo[e]pyrene increases methylation ISO TGFBRAP1 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of TGFBRAP1 intron CTD PMID:30157460 Tgfbrap1 Mouse bisphenol A affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 bisphenol A affects the expression of TGFBRAP1 mRNA CTD PMID:21826169 Tgfbrap1 Mouse bisphenol A affects expression ISO Tgfbrap1 (Rattus norvegicus) 6480464 bisphenol A affects the expression of TGFBRAP1 mRNA CTD PMID:25181051 Tgfbrap1 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TGFBRAP1 mRNA CTD PMID:26063408 Tgfbrap1 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes and Carbon results in increased expression of TGFBRAP1 mRNA CTD PMID:25554681 Tgfbrap1 Mouse chlorpyrifos increases expression EXP 6480464 Chlorpyrifos results in increased expression of TGFBRAP1 mRNA CTD PMID:37019170 Tgfbrap1 Mouse choline multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TGFBRAP1 mRNA CTD PMID:20938992 Tgfbrap1 Mouse dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of TGFBRAP1 mRNA CTD PMID:17361019 and PMID:21266533 Tgfbrap1 Mouse dicrotophos increases expression ISO TGFBRAP1 (Homo sapiens) 6480464 dicrotophos results in increased expression of TGFBRAP1 mRNA CTD PMID:28302478 Tgfbrap1 Mouse epoxiconazole decreases expression EXP 6480464 epoxiconazole results in decreased expression of TGFBRAP1 mRNA CTD PMID:35436446 Tgfbrap1 Mouse fenthion decreases expression EXP 6480464 Fenthion results in decreased expression of TGFBRAP1 mRNA CTD PMID:34813904 Tgfbrap1 Mouse folic acid multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TGFBRAP1 mRNA CTD PMID:20938992 Tgfbrap1 Mouse folic acid decreases expression EXP 6480464 Folic Acid results in decreased expression of TGFBRAP1 mRNA CTD PMID:25629700 Tgfbrap1 Mouse inulin multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of TGFBRAP1 mRNA CTD PMID:36331819 Tgfbrap1 Mouse L-methionine multiple interactions EXP 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased expression of TGFBRAP1 mRNA CTD PMID:20938992 Tgfbrap1 Mouse methapyrilene increases methylation ISO TGFBRAP1 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of TGFBRAP1 intron CTD PMID:30157460 Tgfbrap1 Mouse methidathion decreases expression EXP 6480464 methidathion results in decreased expression of TGFBRAP1 mRNA CTD PMID:34813904 Tgfbrap1 Mouse methoxychlor affects methylation ISO Tgfbrap1 (Rattus norvegicus) 6480464 Methoxychlor affects the methylation of TGFBRAP1 gene CTD PMID:35440735 Tgfbrap1 Mouse panobinostat multiple interactions ISO TGFBRAP1 (Homo sapiens) 6480464 (+)-JQ1 compound promotes the reaction [panobinostat affects the expression of TGFBRAP1 mRNA] and panobinostat promotes the reaction [(+)-JQ1 compound affects the expression of TGFBRAP1 mRNA] CTD PMID:26733615 Tgfbrap1 Mouse panobinostat affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 panobinostat affects the expression of TGFBRAP1 mRNA CTD PMID:26733615 Tgfbrap1 Mouse PCB138 multiple interactions EXP 6480464 [2 more ... CTD PMID:25510870 Tgfbrap1 Mouse pentachlorophenol increases expression EXP 6480464 Pentachlorophenol results in increased expression of TGFBRAP1 mRNA CTD PMID:23892564 Tgfbrap1 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in increased expression of TGFBRAP1 mRNA CTD PMID:36331819 Tgfbrap1 Mouse sodium arsenite decreases expression ISO TGFBRAP1 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of TGFBRAP1 mRNA CTD PMID:38568856 Tgfbrap1 Mouse thiram decreases expression ISO TGFBRAP1 (Homo sapiens) 6480464 Thiram results in decreased expression of TGFBRAP1 mRNA CTD PMID:38568856 Tgfbrap1 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of TGFBRAP1 gene CTD PMID:35295148 Tgfbrap1 Mouse triphenyl phosphate affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of TGFBRAP1 mRNA CTD PMID:37042841 Tgfbrap1 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of TGFBRAP1 mRNA CTD PMID:33045310 Tgfbrap1 Mouse tungsten decreases expression EXP 6480464 Tungsten results in decreased expression of TGFBRAP1 mRNA CTD PMID:30912803 Tgfbrap1 Mouse tunicamycin increases expression EXP 6480464 Tunicamycin results in increased expression of TGFBRAP1 mRNA CTD PMID:17127020 Tgfbrap1 Mouse valproic acid affects expression ISO TGFBRAP1 (Homo sapiens) 6480464 Valproic Acid affects the expression of TGFBRAP1 mRNA CTD PMID:25979313 Tgfbrap1 Mouse zoledronic acid increases expression ISO TGFBRAP1 (Homo sapiens) 6480464 zoledronic acid results in increased expression of TGFBRAP1 protein CTD PMID:28871336
Imported Annotations - PID (archival)
1,2-dimethylhydrazine (EXP) 17beta-estradiol (EXP,ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',5,5'-tetrachlorobiphenyl (EXP) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) arsenite(3-) (ISO) atrazine (ISO) benzo[a]pyrene (EXP) benzo[a]pyrene diol epoxide I (ISO) benzo[e]pyrene (ISO) bisphenol A (EXP,ISO) carbon nanotube (EXP) chlorpyrifos (EXP) choline (EXP) dibutyl phthalate (EXP) dicrotophos (ISO) epoxiconazole (EXP) fenthion (EXP) folic acid (EXP) inulin (EXP) L-methionine (EXP) methapyrilene (ISO) methidathion (EXP) methoxychlor (ISO) panobinostat (ISO) PCB138 (EXP) pentachlorophenol (EXP) perfluorooctane-1-sulfonic acid (EXP) sodium arsenite (ISO) thiram (ISO) titanium dioxide (EXP) triphenyl phosphate (ISO) triptonide (EXP) tungsten (EXP) tunicamycin (EXP) valproic acid (ISO) zoledronic acid (ISO)
Tgfbrap1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 43,086,360 - 43,137,788 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 43,086,360 - 43,137,797 (-) Ensembl GRCm39 Ensembl GRCm38 1 43,047,200 - 43,098,712 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 43,047,200 - 43,098,637 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 43,104,114 - 43,155,467 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 42,991,815 - 43,043,168 (-) NCBI MGSCv36 mm8 Celera 1 43,385,583 - 43,437,075 (-) NCBI Celera Cytogenetic Map 1 B NCBI cM Map 1 22.13 NCBI
TGFBRAP1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 105,249,404 - 105,329,735 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 105,264,391 - 105,329,735 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 105,865,861 - 105,946,192 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 105,249,961 - 105,312,561 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 105,342,059 - 105,404,647 NCBI Celera 2 100,084,016 - 100,146,596 (-) NCBI Celera Cytogenetic Map 2 q12.1-q12.2 NCBI HuRef 2 99,652,442 - 99,693,661 (-) NCBI HuRef CHM1_1 2 105,887,841 - 105,929,095 (-) NCBI CHM1_1 T2T-CHM13v2.0 2 105,710,521 - 105,790,921 (-) NCBI T2T-CHM13v2.0
Tgfbrap1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 52,813,087 - 52,863,441 (-) NCBI GRCr8 mRatBN7.2 9 45,320,975 - 45,371,329 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 45,320,930 - 45,371,311 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 53,815,752 - 53,865,936 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 58,938,553 - 58,988,735 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 57,218,826 - 57,269,178 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 49,852,560 - 49,902,943 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 49,852,560 - 49,902,943 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 49,523,134 - 49,573,517 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 42,251,501 - 42,301,886 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 9 42,255,317 - 42,280,535 (-) NCBI Celera 9 43,038,902 - 43,089,223 (-) NCBI Celera Cytogenetic Map 9 q22 NCBI
Tgfbrap1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955470 10,176,607 - 10,223,234 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955470 10,178,936 - 10,223,234 (-) NCBI ChiLan1.0 ChiLan1.0
TGFBRAP1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 22,388,353 - 22,466,069 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 22,391,136 - 22,468,834 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 96,500,444 - 96,578,068 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 106,338,088 - 106,394,327 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 106,338,098 - 106,394,327 (-) Ensembl panpan1.1 panPan2
TGFBRAP1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 38,096,407 - 38,159,641 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 38,095,547 - 38,157,506 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 38,021,631 - 38,084,686 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 38,952,430 - 39,015,760 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 38,953,286 - 39,015,555 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 38,677,282 - 38,739,914 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 38,956,356 - 39,019,382 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 39,148,381 - 39,211,069 (+) NCBI UU_Cfam_GSD_1.0
Tgfbrap1
TGFBRAP1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 49,466,903 - 49,521,875 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 49,469,898 - 49,521,879 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 51,797,929 - 51,849,414 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TGFBRAP1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 8,900,342 - 8,963,107 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 8,898,587 - 8,942,148 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666041 176,618,479 - 176,684,106 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tgfbrap1
.
Predicted Target Of
Count of predictions: 1088 Count of miRNA genes: 567 Interacting mature miRNAs: 691 Transcripts: ENSMUST00000095014 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 1301011 Cplaq4_m circadian period of locomotor activity 4 (mouse) Not determined 1 9673442 43673601 Mouse 1357524 W6q14_m weight 6 weeks QTL 14 (mouse) Not determined 1 34760138 73976915 Mouse 12910788 Pwgrq9_m post-weaning growth rate QTL 9 (mouse) 1 40868008 67270256 Mouse 1301714 Vertcling_m vertical clinging (mouse) Not determined 1 42938031 76938167 Mouse 1301073 Orch5_m autoimmune orchitis resistance 5 (mouse) Not determined 1 19065351 53065454 Mouse 18182931 Metl1_m metabolite locus 1, pyridoxate (mouse) 1 41275399 75275399 Mouse 1357651 Lgq5_m late growth QTL 5 (mouse) Not determined 1 34760138 73976915 Mouse 12910786 Pwgrq10_m post-weaning growth rate QTL 10 (mouse) 1 40868008 67270256 Mouse 11100001 Col4a1m1_m collagen, type IV, alpha 1 modifier 1 (mouse) 1 25550191 62946882 Mouse 13824984 Twq5_m testis weight QTL 5 (mouse) 1 3069992 184732197 Mouse 1357721 Sle17_m systematic lupus erythematosus susceptibility 17 (mouse) Not determined 1 39132808 126445310 Mouse 1301954 Lrnx11_m learning-contextual 11 (mouse) Not determined 1 39132808 74516365 Mouse 12880407 V125Dq2_m vitamin D active form serum level QTL 2 (mouse) 1 19339081 53339081 Mouse 1357824 Estoq4_m embryo survival total QTL 4 (mouse) Not determined 1 34760138 73976915 Mouse 1357506 W10q6_m weight 10 weeks QTL 6 (mouse) Not determined 1 34760138 73976915 Mouse 4141032 Wbcc1_m white blood cell count 1 (mouse) Not determined 42259667 76259667 Mouse 39128207 Lwq16_m liver weight QTL 16 (mouse) 1 34760138 73976915 Mouse 1558860 W10q7_m weight 10 weeks QTL 7 (mouse) Not determined 1 34760138 150193871 Mouse 12880409 V125Dq1_m vitamin D active form serum level QTL 1 (mouse) 1 26039160 60039160 Mouse 4142433 Hbnr1_m Heligmosomoides bakeri nematode resistance 1 (mouse) Not determined 25550191 58273271 Mouse 1357488 Splq3_m spleen weight QTL 3 (mouse) Not determined 1 34760138 150193871 Mouse 1301240 Sluc15_m susceptibility to lung cancer 15 (mouse) Not determined 1 19065351 53065454 Mouse 1357759 W3q12_m weight 3 weeks QTL 12 (mouse) Not determined 1 34760138 73976915 Mouse 14700685 Civq2_m cerebral infarct volume QTL 2 (mouse) 1 11340482 45340482 Mouse 1357753 Kidq2_m kidney weight QTL 2 (mouse) Not determined 1 34760138 150193871 Mouse 1301756 Pgia1_m proteoglycan induced arthritis 1 (mouse) Not determined 1 19065351 53065454 Mouse 1357475 w3q13_m weight 3 weeks QTL 13 (mouse) Not determined 1 23109591 73976915 Mouse 12910780 Pwgrq11_m post-weaning growth rate QTL 11 (mouse) 1 40868008 67270256 Mouse 1301166 Thypr2_m thymocyte proliferative response 2 (mouse) Not determined 1 41273124 75273271 Mouse
AU024090
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 43,047,319 - 43,047,457 UniSTS GRCm38 MGSCv37 1 43,104,164 - 43,104,302 UniSTS GRCm37 Celera 1 43,385,633 - 43,385,771 UniSTS Cytogenetic Map 1 B UniSTS Whitehead/MRC_RH 1 689.12 UniSTS
RH143145
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 43,048,313 - 43,048,434 UniSTS GRCm38 MGSCv37 1 43,105,158 - 43,105,279 UniSTS GRCm37 Celera 1 43,386,627 - 43,386,748 UniSTS Cytogenetic Map 1 B UniSTS
UniSTS:234120
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 43,047,341 - 43,047,541 UniSTS GRCm38 MGSCv37 1 43,104,186 - 43,104,386 UniSTS GRCm37 Celera 1 43,385,655 - 43,385,855 UniSTS Cytogenetic Map 1 B UniSTS
AW742551
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 1 43,047,907 - 43,048,142 UniSTS GRCm38 MGSCv37 1 43,104,752 - 43,104,987 UniSTS GRCm37 Celera 1 43,386,221 - 43,386,456 UniSTS Cytogenetic Map 1 B UniSTS Whitehead/MRC_RH 1 689.65 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000095014 ⟹ ENSMUSP00000092624
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,086,360 - 43,137,782 (-) Ensembl GRCm38.p6 Ensembl 1 43,047,200 - 43,098,622 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000186694 ⟹ ENSMUSP00000140132
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,086,380 - 43,131,889 (-) Ensembl GRCm38.p6 Ensembl 1 43,047,220 - 43,092,729 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000187525
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,113,401 - 43,131,623 (-) Ensembl GRCm38.p6 Ensembl 1 43,074,241 - 43,092,463 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000187872
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,113,642 - 43,137,797 (-) Ensembl GRCm38.p6 Ensembl 1 43,074,482 - 43,098,637 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000188598
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,093,868 - 43,100,093 (-) Ensembl GRCm38.p6 Ensembl 1 43,054,708 - 43,060,933 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000188728 ⟹ ENSMUSP00000140169
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,099,051 - 43,131,607 (-) Ensembl GRCm38.p6 Ensembl 1 43,059,891 - 43,092,447 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000189010 ⟹ ENSMUSP00000140413
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,114,776 - 43,137,524 (-) Ensembl GRCm38.p6 Ensembl 1 43,075,616 - 43,098,364 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000190427 ⟹ ENSMUSP00000140384
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 43,110,656 - 43,137,768 (-) Ensembl GRCm38.p6 Ensembl 1 43,071,496 - 43,098,608 (-) Ensembl
RefSeq Acc Id:
NM_001013025 ⟹ NP_001013043
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,360 - 43,137,788 (-) NCBI GRCm38 1 43,047,200 - 43,098,628 (-) NCBI MGSCv37 1 43,104,114 - 43,155,467 (-) RGD Celera 1 43,385,583 - 43,437,075 (-) RGD cM Map 1 ENTREZGENE
Sequence:
GTTTATGGCTGGCCGACTCGGCTGACGCACCTCAGCCAAGAGGACGAACTGGGACTGAGAGCGGAGCAGAGTCCTGCCCGGGCTGCGCCGAAAGCACCGGAGGCTAAGCAACGCGAGCTGGCCGCCAT
hide sequence
RefSeq Acc Id:
NM_001357299 ⟹ NP_001344228
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,360 - 43,131,646 (-) NCBI GRCm38 1 43,047,200 - 43,092,486 (-) NCBI
Sequence:
ACGTGACGGGAAGCGGCTGCGGCGGGGCCGGCAGCCCAGGAGCCGCGGCCGGAGCGGGCGGCGGTGCCCCAGGCCGCGGGCGGCGCGGGACGGCTGCGCTACGCGGATCACCCGGTAGACATGATGAA
hide sequence
RefSeq Acc Id:
XM_006496300 ⟹ XP_006496363
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,425 - 43,131,450 (-) NCBI GRCm38 1 43,047,265 - 43,092,291 (-) NCBI
Sequence:
GGTGCCTGCATGACTGGGCCAGATCACCCGGTAGACATGATGAACATCAAGGCCTTCACCTTGG
hide sequence
RefSeq Acc Id:
XM_006496302 ⟹ XP_006496365
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,428 - 43,137,776 (-) NCBI GRCm38 1 43,047,265 - 43,098,712 (-) NCBI
Sequence:
CCGACTCGGCTGACGCACCTCAGCCAAGAGGACGAACTGGGACTGAGAGCGGAGCAGAGTCCTGCCCGGGCTGCGCCGAAAGCACCGGAGGCTAAGCAACGCGAGCTGGCCGCCATTGGTCCCGCCCC
hide sequence
RefSeq Acc Id:
XM_006496303 ⟹ XP_006496366
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,425 - 43,131,579 (-) NCBI GRCm38 1 43,047,265 - 43,092,336 (-) NCBI
Sequence:
CCCAGGCCGCGGGCGGCGCGGGACGGCTGCGCTACGCGGGTGAGAAGCGAGGGGCGGCTTGTTG
hide sequence
RefSeq Acc Id:
XM_011238603 ⟹ XP_011236905
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,428 - 43,137,776 (-) NCBI GRCm38 1 43,047,265 - 43,098,712 (-) NCBI
Sequence:
CCGACTCGGCTGACGCACCTCAGCCAAGAGGACGAACTGGGACTGAGAGCGGAGCAGAGTCCTG
hide sequence
RefSeq Acc Id:
XM_011238604 ⟹ XP_011236906
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,425 - 43,131,616 (-) NCBI GRCm38 1 43,047,265 - 43,092,460 (-) NCBI
Sequence:
GCAGCCCAGGAGCCGCGGCCGGAGCGGGCGGCGGTGCCCCAGGCCGCGGGCGGCGCGGGACGGCTGCGCTACGCGGGTCTGGGGATCCAGCTCAAGTCCGCTGGCTTGACAACAAGCAGCTCCACCTG
hide sequence
RefSeq Acc Id:
XM_030243152 ⟹ XP_030099012
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,425 - 43,131,616 (-) NCBI GRCm38 1 43,047,265 - 43,092,460 (-) NCBI
Sequence:
GCAGCCCAGGAGCCGCGGCCGGAGCGGGCGGCGGTGCCCCAGGCCGCGGGCGGCGCGGGACGGC
hide sequence
RefSeq Acc Id:
XM_036153757 ⟹ XP_036009650
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 43,086,425 - 43,131,603 (-) NCBI
Sequence:
CGCGGCCGGAGCGGGCGGCGGTGCCCCAGGCCGCGGGCGGCGCGGGACGGCTGCGCTACGCGGATCACCCGGTAGACATGATGAACATCAAGGCCTTCACCTTGGTCTCTGCAGTGGAACGGGAACTG
hide sequence
RefSeq Acc Id:
NP_001013043 ⟸ NM_001013025
- UniProtKB:
Q8BKN4 (UniProtKB/Swiss-Prot), Q3UR70 (UniProtKB/Swiss-Prot)
- Sequence:
MMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGATTFAVNESP
hide sequence
RefSeq Acc Id:
XP_006496366 ⟸ XM_006496303
- Peptide Label:
isoform X3
- UniProtKB:
Q8BKN4 (UniProtKB/Swiss-Prot), Q3UR70 (UniProtKB/Swiss-Prot)
- Sequence:
MMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGATTFAVNESP
hide sequence
RefSeq Acc Id:
XP_006496363 ⟸ XM_006496300
- Peptide Label:
isoform X1
- Sequence:
MTGPDHPVDMMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGA
hide sequence
RefSeq Acc Id:
XP_006496365 ⟸ XM_006496302
- Peptide Label:
isoform X3
- UniProtKB:
Q8BKN4 (UniProtKB/Swiss-Prot), Q3UR70 (UniProtKB/Swiss-Prot)
- Sequence:
MMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGATTFAVNESP
hide sequence
RefSeq Acc Id:
XP_011236906 ⟸ XM_011238604
- Peptide Label:
isoform X2
- Sequence:
MISDHPVDMMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGAT
hide sequence
RefSeq Acc Id:
XP_011236905 ⟸ XM_011238603
- Peptide Label:
isoform X2
- Sequence:
MISDHPVDMMNIKAFTLVSAVERELLMGDRDHISIECVECCGRNLYVGTNDCFIYHFLLEEKAMPTGTATFVATKQLHRHLGFKKPVNELCAASALNRLLVLCDNSITLVNMLNLEPVPSGARIKGAT
hide sequence
RefSeq Acc Id:
NP_001344228 ⟸ NM_001357299
- UniProtKB:
Q8BKN4 (UniProtKB/Swiss-Prot), Q3UR70 (UniProtKB/Swiss-Prot)
RefSeq Acc Id:
XP_030099012 ⟸ XM_030243152
- Peptide Label:
isoform X3
- UniProtKB:
Q8BKN4 (UniProtKB/Swiss-Prot), Q3UR70 (UniProtKB/Swiss-Prot)
Ensembl Acc Id:
ENSMUSP00000140132 ⟸ ENSMUST00000186694
Ensembl Acc Id:
ENSMUSP00000140384 ⟸ ENSMUST00000190427
Ensembl Acc Id:
ENSMUSP00000140169 ⟸ ENSMUST00000188728
Ensembl Acc Id:
ENSMUSP00000092624 ⟸ ENSMUST00000095014
Ensembl Acc Id:
ENSMUSP00000140413 ⟸ ENSMUST00000189010
RefSeq Acc Id:
XP_036009650 ⟸ XM_036153757
- Peptide Label:
isoform X4
RGD ID: 6873596 Promoter ID: EPDNEW_M249 Type: initiation region Name: Tgfbrap1_1 Description: Mus musculus transforming growth factor, beta receptor associatedprotein 1 , transcript variant 2, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M250 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 43,092,454 - 43,092,514 EPDNEW
RGD ID: 6873598 Promoter ID: EPDNEW_M250 Type: initiation region Name: Tgfbrap1_2 Description: Mus musculus transforming growth factor, beta receptor associatedprotein 1 , transcript variant 2, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_M249 Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 43,098,647 - 43,098,707 EPDNEW
RGD ID: 6818579 Promoter ID: MM_KWN:585 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Brain, Lung Transcripts: UC007AVG.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 43,117,026 - 43,118,727 (-) MPROMDB
RGD ID: 6817133 Promoter ID: MM_KWN:586 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: AK018453_8430432A02RIK, UC007AVE.1, UC007AVH.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 43,149,096 - 43,149,842 (+) MPROMDB
RGD ID: 6817235 Promoter ID: MM_KWN:587 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, 3T3L1_Day6, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: NM_001013025, OTTMUST00000052200, UC007AVI.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 1 43,155,181 - 43,155,687 (+) MPROMDB
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2024-09-25
Tgfbrap1
transforming growth factor, beta receptor associated protein 1
Tgfbrap1
tansforming growth factor, beta receptor associated protein 1
Symbol and/or name change
5135510 APPROVED
2024-08-21
Tgfbrap1
tansforming growth factor, beta receptor associated protein 1
Tgfbrap1
transforming growth factor, beta receptor associated protein 1
Symbol and/or name change
5135510 APPROVED
