Symbol:
Rnf217
Name:
ring finger protein 217
RGD ID:
1620489
MGI Page
MGI
Description:
Predicted to enable ubiquitin conjugating enzyme binding activity and ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Predicted to be located in membrane. Predicted to be part of ubiquitin ligase complex. Predicted to be active in cytoplasm. Is expressed in adrenal gland; cerebral cortex intermediate zone; cerebral cortex mantle layer; cerebral cortex ventricular layer; and vertebral axis musculature. Orthologous to human RNF217 (ring finger protein 217).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
AI853829; AU016819; E3 ubiquitin-protein ligase RNF217; expressed sequence AI853829; IBR domain containing 1; IBR domain-containing protein 1; Ibrd; Ibrdc1; probable E3 ubiquitin-protein ligase RNF217
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 31,377,883 - 31,485,721 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 31,369,189 - 31,485,180 (-) Ensembl GRCm39 Ensembl GRCm38 10 31,501,887 - 31,609,725 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 31,493,193 - 31,609,184 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 31,221,693 - 31,329,531 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 31,191,301 - 31,300,328 (-) NCBI MGSCv36 mm8 Celera 10 32,427,225 - 32,533,457 (-) NCBI Celera Cytogenetic Map 10 A4 NCBI cM Map 10 17.45 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rnf217 Mouse (-)-epigallocatechin 3-gallate multiple interactions ISO RNF217 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of RNF217 mRNA CTD PMID:22079256 Rnf217 Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of RNF217 mRNA CTD PMID:36331819 Rnf217 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of RNF217 mRNA CTD PMID:22206623 Rnf217 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of RNF217 mRNA CTD PMID:19933214 Rnf217 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Rnf217 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of RNF217 mRNA CTD PMID:32109520 Rnf217 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RNF217 (Homo sapiens) 6480464 [Tetrachlorodibenzodioxin co-treated with 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide] results in increased expression of RNF217 mRNA CTD PMID:29704546 Rnf217 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of RNF217 mRNA CTD PMID:24680724 Rnf217 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of RNF217 mRNA CTD PMID:39298647 Rnf217 Mouse 4-hydroxyphenyl retinamide decreases expression EXP 6480464 Fenretinide results in decreased expression of RNF217 mRNA CTD PMID:28973697 Rnf217 Mouse 6-propyl-2-thiouracil increases expression ISO Rnf217 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of RNF217 mRNA CTD PMID:24780913 Rnf217 Mouse aristolochic acid A decreases expression ISO RNF217 (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of RNF217 mRNA CTD PMID:33212167 Rnf217 Mouse atrazine affects methylation ISO Rnf217 (Rattus norvegicus) 6480464 Atrazine affects the methylation of RNF217 gene CTD PMID:35440735 Rnf217 Mouse belinostat multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNF217 mRNA CTD PMID:27188386 Rnf217 Mouse belinostat increases expression ISO RNF217 (Homo sapiens) 6480464 belinostat results in increased expression of RNF217 mRNA CTD PMID:26272509 Rnf217 Mouse benzo[a]pyrene increases methylation ISO RNF217 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of RNF217 5' UTR CTD PMID:27901495 Rnf217 Mouse bis(2-ethylhexyl) phthalate decreases expression EXP 6480464 Diethylhexyl Phthalate results in decreased expression of RNF217 mRNA CTD PMID:34319233 Rnf217 Mouse bisphenol A affects expression ISO Rnf217 (Rattus norvegicus) 6480464 bisphenol A affects the expression of RNF217 mRNA CTD PMID:25181051 Rnf217 Mouse bisphenol A affects methylation ISO RNF217 (Homo sapiens) 6480464 bisphenol A affects the methylation of RNF217 gene CTD PMID:31601247 Rnf217 Mouse bisphenol A multiple interactions ISO RNF217 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of RNF217 gene CTD PMID:31601247 Rnf217 Mouse bisphenol A increases methylation ISO Rnf217 (Rattus norvegicus) 6480464 bisphenol A results in increased methylation of RNF217 gene CTD PMID:28505145 Rnf217 Mouse bisphenol A decreases expression ISO RNF217 (Homo sapiens) 6480464 bisphenol A results in decreased expression of RNF217 mRNA CTD PMID:27685785 Rnf217 Mouse bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of RNF217 mRNA CTD PMID:38685157 Rnf217 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes and Carbon results in increased expression of RNF217 mRNA CTD PMID:25620056 Rnf217 Mouse chromium(6+) decreases expression ISO RNF217 (Homo sapiens) 6480464 chromium hexavalent ion results in decreased expression of RNF217 mRNA CTD PMID:30690063 Rnf217 Mouse cisplatin multiple interactions ISO RNF217 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of RNF217 mRNA CTD PMID:27392435 Rnf217 Mouse crocidolite asbestos decreases methylation ISO RNF217 (Homo sapiens) 6480464 Asbestos and Crocidolite results in decreased methylation of RNF217 gene CTD PMID:29523930 Rnf217 Mouse cyclosporin A increases expression ISO RNF217 (Homo sapiens) 6480464 Cyclosporine results in increased expression of RNF217 mRNA CTD PMID:25562108 Rnf217 Mouse Dibutyl phosphate affects expression ISO RNF217 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RNF217 mRNA CTD PMID:37042841 Rnf217 Mouse dibutyl phthalate increases expression ISO Rnf217 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of RNF217 mRNA CTD PMID:21266533 Rnf217 Mouse dioxygen increases expression EXP 6480464 Oxygen deficiency results in increased expression of RNF217 mRNA CTD PMID:20880076 Rnf217 Mouse dorsomorphin multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Rnf217 Mouse epoxiconazole increases expression EXP 6480464 epoxiconazole results in increased expression of RNF217 mRNA CTD PMID:35436446 Rnf217 Mouse fluoranthene multiple interactions EXP 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of RNF217 mRNA CTD PMID:28329830 Rnf217 Mouse folic acid decreases expression EXP 6480464 Folic Acid results in decreased expression of RNF217 mRNA CTD PMID:25629700 Rnf217 Mouse fulvestrant multiple interactions ISO RNF217 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] affects the methylation of RNF217 gene CTD PMID:31601247 Rnf217 Mouse gentamycin decreases expression ISO Rnf217 (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of RNF217 mRNA CTD PMID:33387578 Rnf217 Mouse leflunomide increases expression ISO Rnf217 (Rattus norvegicus) 6480464 leflunomide results in increased expression of RNF217 mRNA CTD PMID:24136188 Rnf217 Mouse mercury dibromide increases expression ISO RNF217 (Homo sapiens) 6480464 mercuric bromide results in increased expression of RNF217 mRNA CTD PMID:26272509 Rnf217 Mouse mercury dibromide multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNF217 mRNA CTD PMID:27188386 Rnf217 Mouse methylmercury chloride decreases expression ISO RNF217 (Homo sapiens) 6480464 methylmercuric chloride results in decreased expression of RNF217 mRNA CTD PMID:28001369 Rnf217 Mouse nickel dichloride affects expression ISO Rnf217 (Rattus norvegicus) 6480464 nickel chloride affects the expression of RNF217 mRNA CTD PMID:22110744 Rnf217 Mouse panobinostat multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNF217 mRNA CTD PMID:27188386 Rnf217 Mouse panobinostat increases expression ISO RNF217 (Homo sapiens) 6480464 panobinostat results in increased expression of RNF217 mRNA CTD PMID:26272509 Rnf217 Mouse paracetamol decreases expression ISO Rnf217 (Rattus norvegicus) 6480464 Acetaminophen results in decreased expression of RNF217 mRNA CTD PMID:33387578 Rnf217 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of RNF217 mRNA and [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of RNF217 mRNA CTD PMID:36331819 Rnf217 Mouse phenobarbital affects expression EXP 6480464 Phenobarbital affects the expression of RNF217 mRNA CTD PMID:23091169 Rnf217 Mouse phenylmercury acetate increases expression ISO RNF217 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of RNF217 mRNA CTD PMID:26272509 Rnf217 Mouse phenylmercury acetate multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RNF217 mRNA CTD PMID:27188386 Rnf217 Mouse potassium chromate multiple interactions ISO RNF217 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of RNF217 mRNA CTD PMID:22079256 Rnf217 Mouse potassium chromate decreases expression ISO RNF217 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of RNF217 mRNA CTD PMID:22079256 and PMID:22714537 Rnf217 Mouse potassium dichromate increases expression EXP 6480464 Potassium Dichromate results in increased expression of RNF217 mRNA CTD PMID:23608068 Rnf217 Mouse SB 431542 multiple interactions ISO RNF217 (Homo sapiens) 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Rnf217 Mouse sodium arsenite increases expression ISO RNF217 (Homo sapiens) 6480464 sodium arsenite results in increased expression of RNF217 mRNA CTD PMID:38568856 Rnf217 Mouse sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of RNF217 mRNA CTD PMID:37682722 Rnf217 Mouse sodium arsenite decreases expression ISO RNF217 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of RNF217 mRNA CTD PMID:34032870 Rnf217 Mouse sunitinib increases expression ISO RNF217 (Homo sapiens) 6480464 Sunitinib results in increased expression of RNF217 mRNA CTD PMID:31533062 Rnf217 Mouse tetrachloromethane increases expression ISO Rnf217 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of RNF217 mRNA CTD PMID:31150632 Rnf217 Mouse thioacetamide increases expression ISO Rnf217 (Rattus norvegicus) 6480464 Thioacetamide results in increased expression of RNF217 mRNA CTD PMID:34492290 Rnf217 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of RNF217 gene CTD PMID:35295148 Rnf217 Mouse trichloroethene increases expression ISO Rnf217 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of RNF217 mRNA CTD PMID:33387578 Rnf217 Mouse trichostatin A increases expression ISO RNF217 (Homo sapiens) 6480464 trichostatin A results in increased expression of RNF217 mRNA CTD PMID:24935251 and PMID:26272509 Rnf217 Mouse troglitazone decreases expression EXP 6480464 troglitazone results in decreased expression of RNF217 mRNA CTD PMID:28973697 Rnf217 Mouse valproic acid affects expression ISO RNF217 (Homo sapiens) 6480464 Valproic Acid affects the expression of RNF217 mRNA CTD PMID:25979313 Rnf217 Mouse valproic acid increases expression ISO RNF217 (Homo sapiens) 6480464 Valproic Acid results in increased expression of RNF217 mRNA CTD PMID:23179753 more ...
Rnf217 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 10 31,377,883 - 31,485,721 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 10 31,369,189 - 31,485,180 (-) Ensembl GRCm39 Ensembl GRCm38 10 31,501,887 - 31,609,725 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 10 31,493,193 - 31,609,184 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 10 31,221,693 - 31,329,531 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 10 31,191,301 - 31,300,328 (-) NCBI MGSCv36 mm8 Celera 10 32,427,225 - 32,533,457 (-) NCBI Celera Cytogenetic Map 10 A4 NCBI cM Map 10 17.45 NCBI
RNF217 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 124,962,437 - 125,092,634 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 124,962,437 - 125,092,633 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 125,283,583 - 125,413,780 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 125,346,213 - 125,446,360 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 125,346,212 - 125,446,359 NCBI Celera 6 126,049,522 - 126,149,701 (+) NCBI Celera Cytogenetic Map 6 q22.31 NCBI HuRef 6 122,881,176 - 122,981,254 (+) NCBI HuRef CHM1_1 6 125,567,969 - 125,668,114 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 126,150,465 - 126,280,671 (+) NCBI T2T-CHM13v2.0
Rnf217 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 27,835,741 - 27,927,805 (+) NCBI GRCr8 mRatBN7.2 1 26,016,668 - 26,108,736 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 26,015,728 - 26,108,736 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 25,764,307 - 25,856,182 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 31,764,134 - 31,856,009 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 25,964,885 - 26,056,790 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 28,301,960 - 28,391,582 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 28,301,922 - 28,390,837 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 29,676,521 - 29,846,859 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 26,630,933 - 26,723,874 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 26,556,135 - 26,727,060 (+) NCBI Celera 1 24,711,297 - 24,803,602 (+) NCBI Celera Cytogenetic Map 1 p11 NCBI
Rnf217 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955436 6,458,088 - 6,566,112 (+) NCBI ChiLan1.0 ChiLan1.0
RNF217 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 144,952,595 - 145,081,827 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 142,856,546 - 142,985,343 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 122,747,128 - 122,875,930 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 126,878,597 - 127,001,757 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 126,867,604 - 126,992,867 (+) Ensembl panpan1.1 panPan2
RNF217 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 63,902,985 - 64,094,491 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 63,962,515 - 64,085,011 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 64,771,771 - 64,904,604 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 64,169,156 - 64,302,061 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 64,168,719 - 64,294,050 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 64,100,868 - 64,233,594 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 63,830,960 - 64,020,201 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 64,538,810 - 64,671,819 (+) NCBI UU_Cfam_GSD_1.0
Rnf217
RNF217 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 37,788,472 - 37,912,122 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 37,784,359 - 37,912,122 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 41,674,373 - 41,734,266 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
RNF217
Rnf217
.
Predicted Target Of
Count of predictions: 182 Count of miRNA genes: 165 Interacting mature miRNAs: 169 Transcripts: ENSMUST00000081989 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
39128215 Lwq17_m liver weight QTL 17 (mouse) 10 12704051 84079784 Mouse 1302160 Mbis2_m Mycobacterium bovis-induced systemic lupus erythematosus 2 (mouse) Not determined 10 20283185 56031223 Mouse 1558865 Lith21_m lithogenic gene 21 (mouse) Not determined 10 8525003 42525126 Mouse 15039341 Nmrs28_m NAFLD-associated magnetic resonance shift 28 (mouse) 10 351001 34351001 Mouse 4141943 W6q6_m weight 6 weeks QTL 6 (mouse) Not determined 12704051 84079784 Mouse 27226772 Tibl13_m tibia length 13, 10 week (mouse) 10 18875748 129635869 Mouse 1357656 Hrtq3_m heart weight QTL 3 (mouse) Not determined 10 12704051 84079784 Mouse 26884426 Cvht1_m cranial vault height 1, 5 week (mouse) 10 24675898 121035905 Mouse 4142380 W3q11_m weight 3 weeks QTL 11 (mouse) Not determined 12704051 84079784 Mouse 1357825 Kidpq2_m kidney weight percentage QTL 2 (mouse) Not determined 10 12704051 84079784 Mouse 1300997 Eae15_m susceptibility to experimental allergic encephalomyelitis 15 (mouse) Not determined 10 4408154 38408276 Mouse 1301003 Lmblgq4_m limb length QTL 4 (mouse) Not determined 10 21591192 68091639 Mouse 1301386 Sysbp1_m systolic blood pressure 1 (mouse) Not determined 10 10108265 87401095 Mouse 10045632 Heal16_m wound healing/regeneration 16 (mouse) Not determined 10 30974499 64974630 Mouse 1301129 Alcp15_m alcohol preference locus 15 (mouse) Not determined 10 9890264 43890391 Mouse 10755518 Chol16_m cholesterol 16 (mouse) 10 18915043 52915043 Mouse 1301448 Pas11_m pulmonary adenoma susceptibility 11 (mouse) Not determined 10 9890264 43890391 Mouse 1302092 Ath11_m atherosclerosis 11 (mouse) Not determined 10 6151945 58693521 Mouse 1302067 Scc9_m colon tumor susceptibility 9 (mouse) Not determined 10 18259333 125575232 Mouse 1357813 Ath20_m atherosclerosis 20 (mouse) Not determined 10 3283185 37283334 Mouse 1300790 Pgia6_m proteoglycan induced arthritis 6 (mouse) Not determined 10 3810171 37810295 Mouse 1302133 Alcp16_m alcohol preference locus 16 (mouse) Not determined 10 9890264 43890391 Mouse 26884403 Cvht8_m cranial vault height 8, 16 week (mouse) 10 22875899 91035862 Mouse 26884394 Humsd3_m humerus midshaft diameter 3, 10 week (mouse) 10 22375899 51076096 Mouse 1300898 Cfid_m cystic fibrosis intestinal distress (mouse) Not determined 10 29720403 63720483 Mouse 1558757 Eae34_m experimental allergic encephalomyelitis susceptibility 34 (mouse) Not determined 10 21408154 114217230 Mouse 13208561 Wght8_m weight 8 (mouse) 10 4950000 43875996 Mouse 1357740 Obsty3_m obesity 3 (mouse) Not determined 10 8235478 116190980 Mouse 4141956 Egq7_m early growth QTL 7 (mouse) Not determined 12704051 84079784 Mouse 1357864 Scfpq1_m subcutaneous fat pad percentage QTL 1 (mouse) Not determined 10 12704051 84079784 Mouse 4142209 Psrs1_m psoriasis susceptibility 1 (mouse) Not determined 10 26890264 46720483 Mouse 4142272 W10q5_m weight 10 weeks QTL 5 (mouse) Not determined 12704051 84079784 Mouse
15.MMHAP12FLE3.seq
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 10 31,502,292 - 31,502,490 UniSTS GRCm38 MGSCv37 10 31,222,098 - 31,222,296 UniSTS GRCm37 Celera 10 32,427,630 - 32,427,828 UniSTS Cytogenetic Map 10 A4 UniSTS Whitehead_YAC 10 UniSTS
D10Mit155
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 10 31,550,768 - 31,550,915 UniSTS GRCm38 MGSCv37 10 31,270,574 - 31,270,721 UniSTS GRCm37 Celera 10 32,476,104 - 32,476,251 UniSTS Cytogenetic Map 10 A4 UniSTS cM Map 10 23.0 UniSTS Whitehead Genetic 10 17.5 UniSTS Whitehead_YAC 10 UniSTS
AI853829
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 10 31,501,928 - 31,502,011 UniSTS GRCm38 MGSCv37 10 31,221,734 - 31,221,817 UniSTS GRCm37 Celera 10 32,427,266 - 32,427,349 UniSTS Cytogenetic Map 10 A4 UniSTS Whitehead/MRC_RH 10 405.8 UniSTS Whitehead/MRC_RH 10 408.19 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000081989 ⟹ ENSMUSP00000080650
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 10 31,369,189 - 31,485,180 (-) Ensembl GRCm38.p6 Ensembl 10 31,493,193 - 31,609,184 (-) Ensembl
RefSeq Acc Id:
NM_001146349 ⟹ NP_001139821
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 10 31,377,883 - 31,485,721 (-) NCBI GRCm38 10 31,501,887 - 31,609,725 (-) ENTREZGENE MGSCv37 10 31,221,693 - 31,329,531 (-) RGD Celera 10 32,427,225 - 32,533,457 (-) RGD cM Map 10 ENTREZGENE
Sequence:
AGGGCCCTAGGTGCTGCACGAGGAGAGGGAGGTCTCCCGCTTCTCCTCCAGGGACACCAGCCACTGCTTGCGGACTCGGCCACCTCTCGGTGACGCCACAGGCCCGGCGACCCTCGGGATCGCCGGCT
hide sequence
RefSeq Acc Id:
NP_001139821 ⟸ NM_001146349
- UniProtKB:
D3YYI7 (UniProtKB/Swiss-Prot)
- Sequence:
MGEEQSTVSGSGGARASGGGSAGQPESPRPRGDRVRTAGPRAAASSSRPNGGGGGRDPGCVDASVQEPASNRAPAGQPARLPLSGPLDPQSLELQLEREAEGAGPREAPPGQQPPDGLLLDVLAQRHP
hide sequence
Ensembl Acc Id:
ENSMUSP00000080650 ⟸ ENSMUST00000081989
RGD ID: 6818860 Promoter ID: MM_KWN:3860 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day4, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, Kidney, Liver, Lung, MEF_B4, MEF_B6 Transcripts: ENSMUST00000081989, NM_001146349 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 10 31,328,486 - 31,329,697 (-) MPROMDB
RGD ID: 8671750 Promoter ID: EPDNEW_M13906 Type: initiation region Name: Rnf217_1 Description: Mus musculus ring finger protein 217 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 10 31,609,725 - 31,609,785 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-05-09
Rnf217
ring finger protein 217
AI853829
expressed sequence AI853829
Data merged from RGD:1610556
737654 PROVISIONAL
