Mir23b (microRNA 23b) - Rat Genome Database

Name: Mir23b
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: Mir23b (microRNA 23b) Mus musculus

Analyze

Symbol:

Mir23b

Name:

microRNA 23b

RGD ID:

1607669

MGI Page

MGI

Description:

Acts upstream of or within several processes, including cellular response to lipopolysaccharide; long-term synaptic potentiation; and retina vasculature development in camera-type eye. Is expressed in several structures, including alimentary system; mesothelium; nervous system; sensory organ; and skin. Human ortholog(s) of this gene implicated in hepatocellular carcinoma and ovarian carcinoma. Orthologous to human MIR23B (microRNA 23b).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

Mirn; Mirn23b; mmu-mir-2; mmu-mir-23b

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	13	63,448,298 - 63,448,371 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	13	63,448,298 - 63,448,371 (+)	Ensembl		GRCm39 Ensembl
GRCm38	13	63,300,484 - 63,300,557 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	13	63,300,484 - 63,300,557 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	13	63,401,792 - 63,401,865 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	13	64,954,665 - 64,954,738 (+)	NCBI		Celera
Cytogenetic Map	13	B3	NCBI
cM Map	13	32.8	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Burkitt lymphoma (ISO)

Chemical and Drug Induced Liver Injury (ISO)

cholangiocarcinoma (ISO)

colorectal cancer (ISO)

Experimental Arthritis (IEP,IMP)

Experimental Autoimmune Encephalomyelitis (IEP,IMP)

hepatocellular carcinoma (ISO)

intellectual disability (ISO)

Myocardial Reperfusion Injury (ISO)

obesity (ISO)

ovarian carcinoma (ISO)

rheumatoid arthritis (ISO)

systemic lupus erythematosus (IEP,IMP,ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,3,5-trinitro-1,3,5-triazinane (EXP)

17beta-hydroxy-5alpha-androstan-3-one (ISO)

2-hydroxypropanoic acid (ISO)

5-azacytidine (ISO)

aldehydo-D-glucose (ISO)

arsenite(3-) (ISO)

arsenous acid (ISO)

ATP (ISO)

Benzo[k]fluoranthene (ISO)

beryllium sulfate (ISO)

bleomycin A2 (ISO)

cadmium atom (ISO)

chromium(6+) (ISO)

cisplatin (EXP,ISO)

copper atom (ISO)

copper(0) (ISO)

D-glucose (ISO)

diarsenic trioxide (ISO)

formaldehyde (ISO)

glucose (ISO)

hydrogen peroxide (ISO)

Licochalcone B (ISO)

mechlorethamine (ISO)

methanol (EXP)

morphine (ISO)

N-acetyl-L-cysteine (ISO)

nickel atom (ISO)

nickel sulfate (ISO)

ochratoxin A (ISO)

paracetamol (ISO)

paraquat (EXP)

potassium bromate (ISO)

progesterone (ISO)

rac-lactic acid (ISO)

resveratrol (ISO)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

tetraphene (ISO)

titanium dioxide (EXP)

urethane (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

myelination (IDA)

ossification (IDA)

positive regulation of angiogenesis (IMP)

regulation of gene expression (IMP)

regulation of semaphorin-plexin signaling pathway (IMP)

retina vasculature development in camera-type eye (IMP)

sensory perception of sound (IEP)

References

References - curated

#	Reference Title	Reference Citation
1.	Clinical and biological significance of miR-23b and miR-193a in human hepatocellular carcinoma.	Grossi I, etal., Oncotarget. 2017 Jan 24;8(4):6955-6969. doi: 10.18632/oncotarget.14332.
2.	Circulating MicroRNA-21, MicroRNA-23a, and MicroRNA-125b as Biomarkers for Diagnosis and Prognosis of Burkitt Lymphoma in Children.	Li J, etal., Med Sci Monit. 2016 Dec 19;22:4992-5002. doi: 10.12659/msm.897417.
3.	Adipose-derived exosomes deliver miR-23a/b to regulate tumor growth in hepatocellular cancer by targeting the VHL/HIF axis.	Liu Y, etal., J Physiol Biochem. 2019 Aug;75(3):391-401. doi: 10.1007/s13105-019-00692-6. Epub 2019 Jul 18.
4.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
5.	Potentiality of a triple microRNA classifier: miR-193a-3p, miR-23a and miR-338-5p for early detection of colorectal cancer.	Yong FL, etal., BMC Cancer. 2013 Jun 8;13:280. doi: 10.1186/1471-2407-13-280.
6.	The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-α.	Zhu S, etal., Nat Med. 2012 Jul;18(7):1077-86. doi: 10.1038/nm.2815.

Additional References at PubMed

PMID:12007417	PMID:12554860	PMID:15538371	PMID:15845075	PMID:16381832	PMID:16882971	PMID:17369397	PMID:17604727	PMID:18346711	PMID:18452032	PMID:18716031	PMID:18762567
PMID:19559694	PMID:19582816	PMID:20215419	PMID:20413612	PMID:20736237	PMID:20805985	PMID:21267068	PMID:21536891	PMID:22570807	PMID:22753148	PMID:23646144	PMID:24356489
PMID:24586284	PMID:24651435	PMID:25751060	PMID:25781629	PMID:25858512	PMID:26107743	PMID:26646104	PMID:26748386	PMID:26820568	PMID:26834155	PMID:26839366	PMID:27232518
PMID:27471470	PMID:27636893	PMID:28062322	PMID:28096318	PMID:29288704	PMID:29710503	PMID:29906231	PMID:30188966	PMID:30578296	PMID:31103821	PMID:31138100	PMID:31425535
PMID:31958315	PMID:33357782	PMID:33415668	PMID:33564997	PMID:33737086	PMID:33767433	PMID:33781239	PMID:34107258	PMID:34153312	PMID:34450119	PMID:34479967	PMID:34903122
PMID:35058921	PMID:35380635	PMID:35441352	PMID:35872015	PMID:37064502	PMID:37184476	PMID:37806494	PMID:38054829	PMID:38334823	PMID:38674338	PMID:38813900	PMID:38901181

Genomics

Comparative Map Data

Mir23b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	13	63,448,298 - 63,448,371 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	13	63,448,298 - 63,448,371 (+)	Ensembl		GRCm39 Ensembl
GRCm38	13	63,300,484 - 63,300,557 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	13	63,300,484 - 63,300,557 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	13	63,401,792 - 63,401,865 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	13	64,954,665 - 64,954,738 (+)	NCBI		Celera
Cytogenetic Map	13	B3	NCBI
cM Map	13	32.8	NCBI

MIR23B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	95,085,208 - 95,085,304 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	9	95,085,208 - 95,085,304 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	9	97,847,490 - 97,847,586 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	9	96,887,310 - 96,887,406 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	9	68,288,521 - 68,288,617 (+)	NCBI		Celera
Cytogenetic Map	9	q22.32	NCBI
HuRef	9	67,457,043 - 67,457,139 (+)	NCBI		HuRef
CHM1_1	9	97,993,968 - 97,994,064 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	9	107,254,601 - 107,254,697 (+)	NCBI		T2T-CHM13v2.0

Mir23b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	17	1,819,386 - 1,819,482 (-)	NCBI		GRCr8
mRatBN7.2	17	1,813,667 - 1,813,763 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	17	1,813,667 - 1,813,763 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	17	1,832,365 - 1,832,461 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	17	3,374,963 - 3,375,059 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	17	1,829,815 - 1,829,911 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	17	823,222 - 823,318 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	17	823,222 - 823,318 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	17	816,035 - 816,131 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	17	708,984 - 709,080 (+)	NCBI		Celera
Cytogenetic Map	17	p14	NCBI

MIR23B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	71,678,353 - 71,678,406 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	71,678,346 - 71,678,416 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	72,440,314 - 72,440,367 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	71,982,712 - 71,982,765 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	1	71,982,705 - 71,982,775 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	1	71,794,117 - 71,794,170 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	71,558,186 - 71,558,239 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	72,264,470 - 72,264,523 (-)	NCBI		UU_Cfam_GSD_1.0

MIR23B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	10	27,080,197 - 27,080,276 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	10	27,080,197 - 27,080,276 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	10	31,341,114 - 31,341,193 (-)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir23b
2 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	24500
Count of gene targets:	10663
Count of transcripts:	18216
Interacting mature miRNAs:	mmu-miR-23b-3p, mmu-miR-23b-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300561	Heal7_m	wound healing/regeneration 7 (mouse)			Not determined		13	36144820	70144904	Mouse
4142331	Bxs6_m	BXSB/MpJ autoimmune nephritis 6 (mouse)			Not determined			45210442	83744746	Mouse
12738439	Twq4_m	testis weight QTL 4 (mouse)					13	31129110	65129110	Mouse
4142009	Pregq3_m	pregnancy QTL 3 (mouse)			Not determined		13	20615512	72385189	Mouse
1357587	Pfat3_m	predicted fat percentage 3 (mouse)			Not determined		13	36101530	70101640	Mouse
1300573	Elsgp2_m	elevated serum gp70 2 (mouse)			Not determined		13	50616828	84617027	Mouse
10412109	Bxs7_m	BXSB/MpJ autoimmune nephritis 7 (mouse)			Not determined		13	45210442	83744746	Mouse
10412235	Scgq5_m	spontaneous crescentic glomerulonephritis QTL 5 (mouse)			Not determined		13	36060908	96239162	Mouse
4142314	Tailaq3_m	tail length adjusted QTL 3 (mouse)			Not determined			55720354	112431103	Mouse
1558850	Sgp3_m	serum gp70 production 3 (mouse)			Not determined		13	56470456	76971314	Mouse
4141992	W6q16_m	weight 6 weeks QTL 16 (mouse)			Not determined			55720354	112431103	Mouse
10755517	Chol15_m	cholesterol 15 (mouse)					13	30969467	64969467	Mouse
4142372	Moo2_m	modifier of Odc2 (mouse)			Not determined		X	50318411	84318559	Mouse
15039353	Nmrs35_m	NAFLD-associated magnetic resonance shift 35 (mouse)					13	40588253	74588253	Mouse
10412163	Wra1_m	wheel running activity 1 (mouse)			Not determined		13	59132600	93132738	Mouse
1302157	Bwem2_m	body weight day 30 males 2 (mouse)			Not determined		13	39629249	73629397	Mouse
4142241	Tailq3_m	tail length QTL 3 (mouse)			Not determined			55720354	112431103	Mouse
1301299	Sluc23_m	susceptibility to lung cancer 23 (mouse)			Not determined		13	34921943	68922081	Mouse
4140959	W10q17_m	weight 10 weeks QTL 17 (mouse)			Not determined			55720354	112431103	Mouse
1357553	Cia28_m	collagen induced arthritis 28 (mouse)			Not determined		13	56629249	96239162	Mouse
10755533	Chol18_m	cholesterol 18 (mouse)					13	30969467	64969467	Mouse
1300985	Bmd13_m	bone mineral density 13 (mouse)			Not determined		13	39629249	73629397	Mouse
1302073	Pgct1_m	primordial germ cell tumor locus 1 (mouse)			Not determined		13	53820783	87820897	Mouse
1300862	Cfbw5_m	cystic fibrosis body weight 5 (mouse)			Not determined		13	38720358	72720517	Mouse
1300668	Pas10_m	pulmonary adenoma susceptibility 10 (mouse)			Not determined		13	41489042	75489158	Mouse
1357563	Bmch6_m	bone mechanical trait 6 (mouse)			Not determined		13	55384980	89385140	Mouse
10402414	Sgp5_m	serum gp70 production 5 (mouse)			Not determined		13	56470456	105422186	Mouse
1301666	Eae13_m	susceptibility to experimental allergic encephalomyelitis 13 (mouse)			Not determined		13	50318411	84318559	Mouse
26884393	Humsd7_m	humerus midshaft diameter 7, 16 week (mouse)					13	3950000	76048119	Mouse
1301734	Acsns2_m	Angiostrongylus costaricensis nematode susceptibility 2 (mouse)			Not determined		13	36101530	70101640	Mouse
26884396	Humsd4_m	humerus midshaft diameter 4, 10 week (mouse)					13	47853476	73148119	Mouse
14696729	Kidlq2_m	kidney weight, left QTL 2 (mouse)					13	31344736	65344736	Mouse
1301801	Cpfd5_m	cerebellum pattern fissures (mouse)			Not determined		13	39629249	73629397	Mouse
4142147	Mvwf4_m	modifier of von Willebrand factor 4 (mouse)			Not determined			20477612	112898424	Mouse
14746975	Manh74_m	mandible shape 74 (mouse)					13	52477269	86477269	Mouse

Markers in Region

BE113529

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	13	63,300,438 - 63,300,625	UniSTS	GRCm38
MGSCv37	13	63,401,746 - 63,401,933	UniSTS	GRCm37
Celera	13	64,954,619 - 64,954,806	UniSTS
Cytogenetic Map	13	B3	UniSTS

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029530	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC130827	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459714	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CT009757	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000083665

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	13	63,448,298 - 63,448,371 (+)	Ensembl
GRCm38.p6 Ensembl	13	63,300,484 - 63,300,557 (+)	Ensembl

RefSeq Acc Id:

NR_029530

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	13	63,448,298 - 63,448,371 (+)	NCBI
GRCm38	13	63,300,484 - 63,300,557 (+)	ENTREZGENE
MGSCv37	13	63,401,792 - 63,401,865 (+)	RGD
Celera	13	64,954,665 - 64,954,738 (+)	RGD
cM Map	13		ENTREZGENE

Sequence:

show sequence

GGCTGCTTGGGTTCCTGGCATGCTGATTTGTGACTTGAGATTAAAATCACATTGCCAGGGATTA
CCACGCAACC

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676898	AgrOrtholog
Ensembl Genes	ENSMUSG00000065599	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083665	ENTREZGENE
MGD	MGI:2676898	ENTREZGENE
miRBase	MI0000141	ENTREZGENE
NCBI Gene	387217	ENTREZGENE
PhenoGen	Mir23b	PhenoGen
RNAcentral	URS0000183BED	RNACentral
	URS00005B5CA1	RNACentral
	URS000075D4CE	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD