Symbol:
Mir23b
Name:
microRNA 23b
RGD ID:
1607669
MGI Page
MGI
Description:
Acts upstream of or within several processes, including cellular response to lipopolysaccharide; long-term synaptic potentiation; and retina vasculature development in camera-type eye. Is expressed in several structures, including alimentary system; mesothelium; nervous system; sensory organ; and skin. Human ortholog(s) of this gene implicated in hepatocellular carcinoma and ovarian carcinoma. Orthologous to human MIR23B (microRNA 23b).
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Mirn; Mirn23b; mmu-mir-2; mmu-mir-23b
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 63,448,298 - 63,448,371 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 63,448,298 - 63,448,371 (+) Ensembl GRCm39 Ensembl GRCm38 13 63,300,484 - 63,300,557 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 63,300,484 - 63,300,557 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 63,401,792 - 63,401,865 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 13 64,954,665 - 64,954,738 (+) NCBI Celera Cytogenetic Map 13 B3 NCBI cM Map 13 32.8 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
1.
Clinical and biological significance of miR-23b and miR-193a in human hepatocellular carcinoma.
Grossi I, etal., Oncotarget. 2017 Jan 24;8(4):6955-6969. doi: 10.18632/oncotarget.14332.
2.
Circulating MicroRNA-21, MicroRNA-23a, and MicroRNA-125b as Biomarkers for Diagnosis and Prognosis of Burkitt Lymphoma in Children.
Li J, etal., Med Sci Monit. 2016 Dec 19;22:4992-5002. doi: 10.12659/msm.897417.
3.
Adipose-derived exosomes deliver miR-23a/b to regulate tumor growth in hepatocellular cancer by targeting the VHL/HIF axis.
Liu Y, etal., J Physiol Biochem. 2019 Aug;75(3):391-401. doi: 10.1007/s13105-019-00692-6. Epub 2019 Jul 18.
4.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
5.
Potentiality of a triple microRNA classifier: miR-193a-3p, miR-23a and miR-338-5p for early detection of colorectal cancer.
Yong FL, etal., BMC Cancer. 2013 Jun 8;13:280. doi: 10.1186/1471-2407-13-280.
6.
The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-α.
Zhu S, etal., Nat Med. 2012 Jul;18(7):1077-86. doi: 10.1038/nm.2815.
Mir23b Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 63,448,298 - 63,448,371 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 63,448,298 - 63,448,371 (+) Ensembl GRCm39 Ensembl GRCm38 13 63,300,484 - 63,300,557 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 63,300,484 - 63,300,557 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 63,401,792 - 63,401,865 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 Celera 13 64,954,665 - 64,954,738 (+) NCBI Celera Cytogenetic Map 13 B3 NCBI cM Map 13 32.8 NCBI
MIR23B Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 9 95,085,208 - 95,085,304 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 9 95,085,208 - 95,085,304 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 9 97,847,490 - 97,847,586 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 9 96,887,310 - 96,887,406 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 9 68,288,521 - 68,288,617 (+) NCBI Celera Cytogenetic Map 9 q22.32 NCBI HuRef 9 67,457,043 - 67,457,139 (+) NCBI HuRef CHM1_1 9 97,993,968 - 97,994,064 (+) NCBI CHM1_1 T2T-CHM13v2.0 9 107,254,601 - 107,254,697 (+) NCBI T2T-CHM13v2.0
Mir23b Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 1,819,386 - 1,819,482 (-) NCBI GRCr8 mRatBN7.2 17 1,813,667 - 1,813,763 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 1,813,667 - 1,813,763 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 17 1,832,365 - 1,832,461 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 17 3,374,963 - 3,375,059 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 17 1,829,815 - 1,829,911 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 17 823,222 - 823,318 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 823,222 - 823,318 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 816,035 - 816,131 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 17 708,984 - 709,080 (+) NCBI Celera Cytogenetic Map 17 p14 NCBI
MIR23B Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 1 71,678,353 - 71,678,406 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 1 71,678,346 - 71,678,416 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 1 72,440,314 - 72,440,367 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 1 71,982,712 - 71,982,765 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 1 71,982,705 - 71,982,775 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 1 71,794,117 - 71,794,170 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 1 71,558,186 - 71,558,239 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 1 72,264,470 - 72,264,523 (-) NCBI UU_Cfam_GSD_1.0
MIR23B Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 10 27,080,197 - 27,080,276 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 10 27,080,197 - 27,080,276 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 10 31,341,114 - 31,341,193 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
.
Predicted Targets
Count of predictions: 24500 Count of gene targets: 10663 Count of transcripts: 18216 Interacting mature miRNAs: mmu-miR-23b-3p, mmu-miR-23b-5p Prediction methods: Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan Result types: miRGate_prediction
1300561 Heal7_m wound healing/regeneration 7 (mouse) Not determined 13 36144820 70144904 Mouse 4142331 Bxs6_m BXSB/MpJ autoimmune nephritis 6 (mouse) Not determined 45210442 83744746 Mouse 12738439 Twq4_m testis weight QTL 4 (mouse) 13 31129110 65129110 Mouse 4142009 Pregq3_m pregnancy QTL 3 (mouse) Not determined 13 20615512 72385189 Mouse 1357587 Pfat3_m predicted fat percentage 3 (mouse) Not determined 13 36101530 70101640 Mouse 1300573 Elsgp2_m elevated serum gp70 2 (mouse) Not determined 13 50616828 84617027 Mouse 10412109 Bxs7_m BXSB/MpJ autoimmune nephritis 7 (mouse) Not determined 13 45210442 83744746 Mouse 10412235 Scgq5_m spontaneous crescentic glomerulonephritis QTL 5 (mouse) Not determined 13 36060908 96239162 Mouse 4142314 Tailaq3_m tail length adjusted QTL 3 (mouse) Not determined 55720354 112431103 Mouse 1558850 Sgp3_m serum gp70 production 3 (mouse) Not determined 13 56470456 76971314 Mouse 4141992 W6q16_m weight 6 weeks QTL 16 (mouse) Not determined 55720354 112431103 Mouse 10755517 Chol15_m cholesterol 15 (mouse) 13 30969467 64969467 Mouse 4142372 Moo2_m modifier of Odc2 (mouse) Not determined X 50318411 84318559 Mouse 15039353 Nmrs35_m NAFLD-associated magnetic resonance shift 35 (mouse) 13 40588253 74588253 Mouse 10412163 Wra1_m wheel running activity 1 (mouse) Not determined 13 59132600 93132738 Mouse 1302157 Bwem2_m body weight day 30 males 2 (mouse) Not determined 13 39629249 73629397 Mouse 4142241 Tailq3_m tail length QTL 3 (mouse) Not determined 55720354 112431103 Mouse 1301299 Sluc23_m susceptibility to lung cancer 23 (mouse) Not determined 13 34921943 68922081 Mouse 4140959 W10q17_m weight 10 weeks QTL 17 (mouse) Not determined 55720354 112431103 Mouse 1357553 Cia28_m collagen induced arthritis 28 (mouse) Not determined 13 56629249 96239162 Mouse 10755533 Chol18_m cholesterol 18 (mouse) 13 30969467 64969467 Mouse 1300985 Bmd13_m bone mineral density 13 (mouse) Not determined 13 39629249 73629397 Mouse 1302073 Pgct1_m primordial germ cell tumor locus 1 (mouse) Not determined 13 53820783 87820897 Mouse 1300862 Cfbw5_m cystic fibrosis body weight 5 (mouse) Not determined 13 38720358 72720517 Mouse 1300668 Pas10_m pulmonary adenoma susceptibility 10 (mouse) Not determined 13 41489042 75489158 Mouse 1357563 Bmch6_m bone mechanical trait 6 (mouse) Not determined 13 55384980 89385140 Mouse 10402414 Sgp5_m serum gp70 production 5 (mouse) Not determined 13 56470456 105422186 Mouse 1301666 Eae13_m susceptibility to experimental allergic encephalomyelitis 13 (mouse) Not determined 13 50318411 84318559 Mouse 26884393 Humsd7_m humerus midshaft diameter 7, 16 week (mouse) 13 3950000 76048119 Mouse 1301734 Acsns2_m Angiostrongylus costaricensis nematode susceptibility 2 (mouse) Not determined 13 36101530 70101640 Mouse 26884396 Humsd4_m humerus midshaft diameter 4, 10 week (mouse) 13 47853476 73148119 Mouse 14696729 Kidlq2_m kidney weight, left QTL 2 (mouse) 13 31344736 65344736 Mouse 1301801 Cpfd5_m cerebellum pattern fissures (mouse) Not determined 13 39629249 73629397 Mouse 4142147 Mvwf4_m modifier of von Willebrand factor 4 (mouse) Not determined 20477612 112898424 Mouse 14746975 Manh74_m mandible shape 74 (mouse) 13 52477269 86477269 Mouse
BE113529
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 13 63,300,438 - 63,300,625 UniSTS GRCm38 MGSCv37 13 63,401,746 - 63,401,933 UniSTS GRCm37 Celera 13 64,954,619 - 64,954,806 UniSTS Cytogenetic Map 13 B3 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000083665
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 63,448,298 - 63,448,371 (+) Ensembl GRCm38.p6 Ensembl 13 63,300,484 - 63,300,557 (+) Ensembl
RefSeq Acc Id:
NR_029530
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 63,448,298 - 63,448,371 (+) NCBI GRCm38 13 63,300,484 - 63,300,557 (+) ENTREZGENE MGSCv37 13 63,401,792 - 63,401,865 (+) RGD Celera 13 64,954,665 - 64,954,738 (+) RGD cM Map 13 ENTREZGENE
Sequence:
GGCTGCTTGGGTTCCTGGCATGCTGATTTGTGACTTGAGATTAAAATCACATTGCCAGGGATTACCACGCAACC
hide sequence
