Symbol:
Napb
Name:
NSF attachment protein beta
RGD ID:
1589649
Description:
Enables syntaxin binding activity. Involved in protein-containing complex disassembly; regulation of ATP-dependent activity; and regulation of receptor internalization. Is active in postsynapse and presynaptic active zone membrane. Human ortholog(s) of this gene implicated in developmental and epileptic encephalopathy 107. Orthologous to human NAPB (NSF attachment protein beta); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acetamiprid.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
Beta-soluble NSF attachment protein; LOC499903; N-ethylmaleimide sensitive fusion protein attachment protein beta; N-ethylmaleimide-sensitive factor attachment protein beta; N-ethylmaleimide-sensitive factor attachment protein, beta; similar to N-ethylmaleimide sensitive fusion protein attachment protein beta; SNAP-beta; Snapb
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Allele / Splice:
NapbTn(sb-T2/Bart3)2.162Mcwi
Genetic Models:
F344-NapbTn(sb-T2/Bart3)2.162Mcwi
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 156,585,394 - 156,632,418 (-) NCBI GRCr8 mRatBN7.2 3 136,132,248 - 136,179,280 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 136,133,428 - 136,179,345 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 140,088,084 - 140,131,334 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 148,672,232 - 148,715,485 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 146,361,580 - 146,404,830 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 143,017,571 - 143,063,904 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 143,020,454 - 143,063,983 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 149,431,212 - 149,473,190 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 137,447,072 - 137,490,500 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 3 134,978,251 - 135,020,908 (-) NCBI Celera Cytogenetic Map 3 q41 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Napb Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO RGD:1317300 6480464 [TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in decreased expression more ... CTD PMID:25975270 Napb Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of NAPB mRNA CTD PMID:33387578 Napb Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO RGD:1317300 6480464 tetrabromobisphenol A results in increased expression of NAPB mRNA CTD PMID:25172293 Napb Rat 3,4-methylenedioxymethamphetamine decreases expression ISO RGD:1317300 6480464 N-Methyl-3,4-methylenedioxyamphetamine results in decreased expression of NAPB mRNA CTD PMID:20188158 Napb Rat 4,4'-diaminodiphenylmethane decreases expression ISO RGD:1317300 6480464 4,4'-diaminodiphenylmethane results in decreased expression of NAPB mRNA CTD PMID:18648102 Napb Rat 4-hydroxynon-2-enal increases expression ISO RGD:1317300 6480464 4-hydroxy-2-nonenal results in increased expression of NAPB mRNA CTD PMID:19191707 Napb Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of NAPB mRNA CTD PMID:24780913 Napb Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of NAPB mRNA CTD PMID:36843608 Napb Rat acetamiprid increases expression EXP 6480464 acetamiprid results in increased expression of NAPB mRNA CTD PMID:27782041 Napb Rat aflatoxin B1 increases expression ISO RGD:1317300 6480464 Aflatoxin B1 results in increased expression of NAPB mRNA CTD PMID:19770486 Napb Rat arsane multiple interactions ISO RGD:1317299 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of NAPB more ... CTD PMID:39836092 Napb Rat arsenic atom multiple interactions ISO RGD:1317299 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of NAPB more ... CTD PMID:39836092 Napb Rat arsenite(3-) multiple interactions ISO RGD:1317300 6480464 [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of NAPB mRNA CTD PMID:15894712 Napb Rat arsenite(3-) decreases expression ISO RGD:1317300 6480464 arsenite results in decreased expression of NAPB mRNA CTD PMID:15894712 Napb Rat arsenous acid multiple interactions ISO RGD:1317299 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to NAPB protein] CTD PMID:26598702 Napb Rat benzo[a]pyrene multiple interactions ISO RGD:1317300 6480464 [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of NAPB mRNA CTD PMID:15894712 Napb Rat benzo[a]pyrene decreases expression ISO RGD:1317300 6480464 Benzo(a)pyrene results in decreased expression of NAPB mRNA CTD PMID:15894712 Napb Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of NAPB mRNA CTD PMID:25181051|PMID:30816183|PMID:34947998|PMID:38750585 Napb Rat bisphenol A decreases expression ISO RGD:1317300 6480464 bisphenol A results in decreased expression of NAPB mRNA CTD PMID:32156529 Napb Rat Brodifacoum increases expression EXP 6480464 bromfenacoum results in increased expression of NAPB protein CTD PMID:28903499 Napb Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of NAPB mRNA CTD PMID:33453195 Napb Rat carbon nanotube increases expression ISO RGD:1317300 6480464 Nanotubes, Carbon results in increased expression of NAPB mRNA CTD PMID:25620056 Napb Rat chlordecone increases expression ISO RGD:1317300 6480464 Chlordecone results in increased expression of NAPB mRNA CTD PMID:33711761 Napb Rat clofibrate multiple interactions ISO RGD:1317300 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of NAPB mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Napb Rat crocidolite asbestos decreases expression ISO RGD:1317299 6480464 Asbestos, Crocidolite results in decreased expression of NAPB mRNA CTD PMID:29523930 Napb Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of NAPB mRNA CTD PMID:26577399 Napb Rat cyclosporin A increases expression ISO RGD:1317299 6480464 Cyclosporine results in increased expression of NAPB mRNA CTD PMID:27989131 Napb Rat diarsenic trioxide multiple interactions ISO RGD:1317299 6480464 Arsenic Trioxide inhibits the reaction [4-aminophenylarsenoxide binds to NAPB protein] CTD PMID:26598702 Napb Rat Dibutyl phosphate affects expression ISO RGD:1317299 6480464 di-n-butylphosphoric acid affects the expression of NAPB mRNA CTD PMID:37042841 Napb Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of NAPB mRNA CTD PMID:29391264 Napb Rat ethanol multiple interactions ISO RGD:1317300 6480464 Ethanol affects the expression of and affects the splicing of NAPB mRNA CTD PMID:30319688 Napb Rat ethyl methanesulfonate increases expression ISO RGD:1317299 6480464 Ethyl Methanesulfonate results in increased expression of NAPB mRNA CTD PMID:23649840 Napb Rat fenamidone decreases expression ISO RGD:1317300 6480464 fenamidone results in decreased expression of NAPB mRNA CTD PMID:27029645 Napb Rat formaldehyde decreases expression ISO RGD:1317299 6480464 Formaldehyde results in decreased expression of NAPB mRNA CTD PMID:20655997 Napb Rat gamma-tocopherol increases expression ISO RGD:1317300 6480464 Tocopherols results in increased expression of NAPB mRNA CTD PMID:17654050 Napb Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of NAPB mRNA CTD PMID:33387578 Napb Rat GSK-J4 increases expression ISO RGD:1317299 6480464 GSK-J4 results in increased expression of NAPB mRNA CTD PMID:29301935 Napb Rat hydrogen sulfide decreases expression ISO RGD:1317300 6480464 Hydrogen Sulfide results in decreased expression of NAPB protein CTD PMID:29932956 Napb Rat ivermectin decreases expression ISO RGD:1317299 6480464 Ivermectin results in decreased expression of NAPB protein CTD PMID:32959892 Napb Rat lead(0) affects expression ISO RGD:1317299 6480464 Lead affects the expression of NAPB mRNA CTD PMID:28903495 Napb Rat methyl methanesulfonate increases expression ISO RGD:1317299 6480464 Methyl Methanesulfonate results in increased expression of NAPB mRNA CTD PMID:23649840 Napb Rat N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal increases expression ISO RGD:1317300 6480464 benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of NAPB mRNA CTD PMID:25566086 Napb Rat nickel sulfate decreases expression ISO RGD:1317299 6480464 nickel sulfate results in decreased expression of NAPB mRNA CTD PMID:22714537 Napb Rat paracetamol multiple interactions ISO RGD:1317300 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of NAPB mRNA; PPARA affects the reaction [[Clofibrate more ... CTD PMID:17585979 Napb Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of NAPB mRNA CTD PMID:33387578 Napb Rat paracetamol affects expression ISO RGD:1317300 6480464 Acetaminophen affects the expression of NAPB mRNA CTD PMID:17562736 Napb Rat poly(I:C) multiple interactions EXP 6480464 [Poly I-C co-treated with HU 211] results in decreased expression of NAPB mRNA CTD PMID:26923065 Napb Rat quercetin increases expression ISO RGD:1317299 6480464 Quercetin results in increased expression of NAPB mRNA CTD PMID:21632981 Napb Rat sodium arsenite decreases expression ISO RGD:1317299 6480464 sodium arsenite results in decreased expression of NAPB mRNA CTD PMID:22714537 Napb Rat sodium arsenite multiple interactions ISO RGD:1317299 6480464 [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of NAPB more ... CTD PMID:39836092 Napb Rat sodium arsenite increases expression ISO RGD:1317299 6480464 sodium arsenite results in increased expression of NAPB mRNA CTD PMID:38568856 Napb Rat sodium fluoride increases expression ISO RGD:1317300 6480464 Sodium Fluoride results in increased expression of NAPB mRNA CTD PMID:27862939 Napb Rat Soman decreases expression EXP 6480464 Soman results in decreased expression of NAPB mRNA CTD PMID:19281266 Napb Rat sunitinib increases expression ISO RGD:1317299 6480464 Sunitinib results in increased expression of NAPB mRNA CTD PMID:31533062 Napb Rat titanium dioxide decreases methylation ISO RGD:1317300 6480464 titanium dioxide results in decreased methylation of NAPB gene CTD PMID:35295148 Napb Rat tocopherol increases expression ISO RGD:1317300 6480464 Tocopherols results in increased expression of NAPB mRNA CTD PMID:17654050 Napb Rat triphenyl phosphate affects expression ISO RGD:1317299 6480464 triphenyl phosphate affects the expression of NAPB mRNA CTD PMID:37042841 Napb Rat triptonide increases expression ISO RGD:1317300 6480464 triptonide results in increased expression of NAPB mRNA CTD PMID:33045310 Napb Rat tris(2-butoxyethyl) phosphate affects expression ISO RGD:1317299 6480464 tris(2-butoxyethyl) phosphate affects the expression of NAPB mRNA CTD PMID:29024780 Napb Rat trovafloxacin increases expression ISO RGD:1317300 6480464 trovafloxacin results in increased expression of NAPB mRNA CTD PMID:35537566 Napb Rat valproic acid affects expression ISO RGD:1317300 6480464 Valproic Acid affects the expression of NAPB mRNA CTD PMID:17963808 Napb Rat vincristine increases expression ISO RGD:1317299 6480464 Vincristine results in increased expression of NAPB mRNA CTD PMID:23649840
2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3,4-methylenedioxymethamphetamine (ISO) 4,4'-diaminodiphenylmethane (ISO) 4-hydroxynon-2-enal (ISO) 6-propyl-2-thiouracil (EXP) acetamiprid (EXP) aflatoxin B1 (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) arsenous acid (ISO) benzo[a]pyrene (ISO) bisphenol A (EXP,ISO) Brodifacoum (EXP) cadmium dichloride (EXP) carbon nanotube (ISO) chlordecone (ISO) clofibrate (ISO) crocidolite asbestos (ISO) Cuprizon (EXP) cyclosporin A (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) endosulfan (EXP) ethanol (ISO) ethyl methanesulfonate (ISO) fenamidone (ISO) formaldehyde (ISO) gamma-tocopherol (ISO) gentamycin (EXP) GSK-J4 (ISO) hydrogen sulfide (ISO) ivermectin (ISO) lead(0) (ISO) methyl methanesulfonate (ISO) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (ISO) nickel sulfate (ISO) paracetamol (EXP,ISO) poly(I:C) (EXP) quercetin (ISO) sodium arsenite (ISO) sodium fluoride (ISO) Soman (EXP) sunitinib (ISO) titanium dioxide (ISO) tocopherol (ISO) triphenyl phosphate (ISO) triptonide (ISO) tris(2-butoxyethyl) phosphate (ISO) trovafloxacin (ISO) valproic acid (ISO) vincristine (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
NSF ATPase and alpha-/beta-SNAPs disassemble the AMPA receptor-PICK1 complex.
Hanley JG, etal., Neuron 2002 Mar 28;34(1):53-67.
3.
Distribution of soluble N-ethylmaleimide fusion protein attachment proteins (SNAPs) in the rat nervous system.
Nishiki T, etal., Neuroscience. 2001;107(3):363-71.
4.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
5.
GOA pipeline
RGD automated data pipeline
6.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
7.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
8.
Comprehensive gene review and curation
RGD comprehensive gene curation
9.
Synaptosomal proteins, beta-soluble N-ethylmaleimide-sensitive factor attachment protein (beta-SNAP), gamma-SNAP and synaptotagmin I in brain of patients with Down syndrome and Alzheimer's disease.
Yoo BC, etal., Dement Geriatr Cogn Disord. 2001 May-Jun;12(3):219-25.
Napb Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 3 156,585,394 - 156,632,418 (-) NCBI GRCr8 mRatBN7.2 3 136,132,248 - 136,179,280 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 3 136,133,428 - 136,179,345 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 3 140,088,084 - 140,131,334 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 3 148,672,232 - 148,715,485 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 3 146,361,580 - 146,404,830 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 3 143,017,571 - 143,063,904 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 3 143,020,454 - 143,063,983 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 3 149,431,212 - 149,473,190 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 3 137,447,072 - 137,490,500 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 3 134,978,251 - 135,020,908 (-) NCBI Celera Cytogenetic Map 3 q41 NCBI
NAPB Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 20 23,374,522 - 23,421,488 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 20 23,374,519 - 23,421,519 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 20 23,355,159 - 23,402,125 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 20 23,303,165 - 23,350,081 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 20 23,303,165 - 23,350,081 NCBI Celera 20 23,428,529 - 23,475,530 (-) NCBI Celera Cytogenetic Map 20 p11.21 NCBI HuRef 20 23,316,796 - 23,363,800 (-) NCBI HuRef CHM1_1 20 23,355,618 - 23,402,617 (-) NCBI CHM1_1 T2T-CHM13v2.0 20 23,434,062 - 23,481,033 (-) NCBI T2T-CHM13v2.0
Napb Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 2 148,535,905 - 148,574,396 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 2 148,535,905 - 148,574,387 (-) Ensembl GRCm39 Ensembl GRCm38 2 148,693,985 - 148,732,425 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 2 148,693,985 - 148,732,467 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 2 148,520,393 - 148,558,156 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 2 148,386,098 - 148,423,861 (-) NCBI MGSCv36 mm8 Celera 2 149,962,927 - 150,000,652 (-) NCBI Celera Cytogenetic Map 2 G3 NCBI cM Map 2 73.53 NCBI
Napb Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955415 30,392,165 - 30,427,773 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955415 30,392,692 - 30,427,773 (-) NCBI ChiLan1.0 ChiLan1.0
NAPB Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 21 24,247,686 - 24,294,702 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 20 24,244,519 - 24,291,535 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 20 23,316,153 - 23,363,142 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 20 23,667,464 - 23,713,935 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 20 23,667,469 - 23,713,935 (-) Ensembl panpan1.1 panPan2
NAPB Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 24 217,287 - 258,278 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 24 217,381 - 255,752 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 24 239,058 - 280,048 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 24 609,668 - 650,674 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 24 609,687 - 650,669 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 24 211,965 - 252,952 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 24 311,328 - 352,320 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 24 595,207 - 636,199 (+) NCBI UU_Cfam_GSD_1.0
Napb Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 148,737,781 - 148,785,166 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936620 2,157,528 - 2,205,586 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936620 2,158,246 - 2,205,624 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
NAPB Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 17 30,359,420 - 30,396,083 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 17 30,361,439 - 30,396,105 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 17 34,450,374 - 34,485,114 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
NAPB
Napb
.
Predicted Target Of
Count of predictions: 37 Count of miRNA genes: 33 Interacting mature miRNAs: 36 Transcripts: ENSRNOT00000006329 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2312673 Scl63 Serum cholesterol level QTL 63 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 3 98535255 168026850 Rat 1598877 Bp285 Blood pressure QTL 285 1.5 0.03 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 120538241 165538241 Rat 1578653 Vnigr3 Vascular neointimal growth QTL 3 3.1 artery morphology trait (VT:0002191) artery neointimal hyperplastic lesion area (CMO:0001414) 3 130656562 169034231 Rat 2302373 Gluco39 Glucose level QTL 39 5.01 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 3 98535386 161695835 Rat 70216 Cm14 Cardiac mass QTL 14 2.1 heart mass (VT:0007028) heart wet weight (CMO:0000069) 3 31172320 163586636 Rat 2292591 Esta4 Estrogen-induced thymic atrophy QTL 4 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 3 47233211 147415807 Rat 1581568 Rf53 Renal function QTL 53 urine total protein amount (VT:0000032) urine protein excretion rate to body weight ratio (CMO:0001099) 3 56395968 161299569 Rat 1578754 Stresp16 Stress response QTL 16 4 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 3 112681431 157681431 Rat 1300173 Rf11 Renal function QTL 11 3.38 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 3 121056165 145956249 Rat 9589106 Insul23 Insulin level QTL 23 13.86 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 3 131635904 169034231 Rat 8694437 Bw167 Body weight QTL 167 22.46 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 3 91797474 136797474 Rat 10755461 Coatc16 Coat color QTL 16 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 3 122438700 167438700 Rat 8662816 Vetf4 Vascular elastic tissue fragility QTL 4 4 renal artery integrity trait (VT:0010642) number of ruptures of the internal elastic lamina of the renal arteries (CMO:0002563) 3 59242096 157323038 Rat 1559282 Emca5 Estrogen-induced mammary cancer QTL 5 3.9 mammary gland integrity trait (VT:0010552) percentage of study population developing mammary tumors during a period of time (CMO:0000948) 3 43827364 169034231 Rat 1354611 Despr2 Despair related QTL 2 3.03 0.0028 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 3 97084464 142084464 Rat 2303620 Vencon4 Ventilatory control QTL 4 3.9 respiration trait (VT:0001943) tidal volume (CMO:0000222) 3 127162703 168026850 Rat 631841 Niddm39 Non-insulin dependent diabetes mellitus QTL 39 3.36 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 94856903 159898684 Rat 1576306 Schws3 Schwannoma susceptibility QTL 3 0.001 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 3 118839124 163839124 Rat 619618 Rf3 Renal disease susceptibility QTL 3 6.5 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate to body weight ratio (CMO:0001270) 3 107693393 152693393 Rat 1300159 Kidm4 Kidney mass QTL 4 3.83 kidney mass (VT:0002707) right kidney wet weight to body weight ratio (CMO:0001953) 3 121056165 157309487 Rat 2301971 Cm71 Cardiac mass QTL 71 4.63 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 3 41874578 155617519 Rat 2312659 Slep7 Serum leptin concentration QTL 7 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 3 98535255 168026850 Rat 631673 Iddm13 Insulin dependent diabetes mellitus QTL 13 1.3 0.663 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 3 130193298 161695983 Rat 2301970 Bw81 Body weight QTL 81 5.19 body mass (VT:0001259) body weight (CMO:0000012) 3 41874578 155617519 Rat 1581546 Pur13 Proteinuria QTL 13 2.93 0.0335 urine total protein amount (VT:0000032) urine protein excretion rate (CMO:0000759) 3 78196190 146592722 Rat 1578656 Vnigr2 Vascular neointimal growth QTL 2 4.2 artery morphology trait (VT:0002191) lesioned artery residual lumen area (CMO:0001417) 3 130656562 169034231 Rat 631541 Bp81 Blood pressure QTL 81 4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 3 124122556 169034231 Rat 2293087 Iddm27 Insulin dependent diabetes mellitus QTL 27 2.68 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 3 97551417 147415807 Rat 2312670 Bw94 Body weight QTL 94 0.01 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 3 98535255 168026850 Rat 724532 Cm17 Cardiac mass QTL 17 2 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 3 95735366 140735366 Rat
BE113916
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 136,142,093 - 136,142,260 (+) MAPPER mRatBN7.2 Rnor_6.0 3 143,026,777 - 143,026,943 NCBI Rnor6.0 Rnor_5.0 3 149,437,337 - 149,437,503 UniSTS Rnor5.0 RGSC_v3.4 3 137,453,197 - 137,453,363 UniSTS RGSC3.4 Celera 3 134,984,376 - 134,984,542 UniSTS Cytogenetic Map 3 q41 UniSTS
RH135049
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 3 136,175,530 - 136,175,746 (+) MAPPER mRatBN7.2 Rnor_6.0 3 143,060,210 - 143,060,425 NCBI Rnor6.0 Rnor_5.0 3 149,469,496 - 149,469,711 UniSTS Rnor5.0 RGSC_v3.4 3 137,486,806 - 137,487,021 UniSTS RGSC3.4 Celera 3 135,017,214 - 135,017,429 UniSTS RH 3.4 Map 3 1291.2 UniSTS Cytogenetic Map 3 q41 UniSTS
This gene Napb is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000006329 ⟹ ENSRNOP00000006329
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 3 136,133,428 - 136,179,345 (-) Ensembl Rnor_6.0 Ensembl 3 143,020,454 - 143,063,983 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000100069 ⟹ ENSRNOP00000083784
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 3 136,133,428 - 136,179,345 (-) Ensembl
RefSeq Acc Id:
NM_001191966 ⟹ NP_001178895
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 156,585,394 - 156,632,418 (-) NCBI mRatBN7.2 3 136,132,248 - 136,179,280 (-) NCBI Rnor_6.0 3 143,020,652 - 143,063,904 (-) NCBI Rnor_5.0 3 149,431,212 - 149,473,190 (-) NCBI Celera 3 134,978,251 - 135,020,908 (-) NCBI
Sequence:
ATGGACAACGCAGGGAAAGAACGAGAAGCGGTCCAGCTTATGGCGGAGGCCGAGAAGCGAGTGAAGGCTTCCCACTCCTTCCTCCGAGGGTTGTTCGGAGGAAACACAAGAATAGAAGAGGCATGTGA
hide sequence
RefSeq Acc Id:
XM_039105702 ⟹ XP_038961630
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 3 156,585,394 - 156,604,722 (-) NCBI mRatBN7.2 3 136,132,248 - 136,151,587 (-) NCBI
RefSeq Acc Id:
NP_001178895 ⟸ NM_001191966
- UniProtKB:
P85969 (UniProtKB/Swiss-Prot), A6K7C6 (UniProtKB/Swiss-Prot), F8WFM2 (UniProtKB/TrEMBL)
- Sequence:
MDNAGKEREAVQLMAEAEKRVKASHSFLRGLFGGNTRIEEACEMYTRAANMFKMAKNWSAAGNAFCQAAKLHMQLQSKHDSATSFVDAGNAYKKADPQEAINCLNAAIDIYTDMGRFTIAAKHHITIA
hide sequence
Ensembl Acc Id:
ENSRNOP00000006329 ⟸ ENSRNOT00000006329
RefSeq Acc Id:
XP_038961630 ⟸ XM_039105702
- Peptide Label:
isoform X1
Ensembl Acc Id:
ENSRNOP00000083784 ⟸ ENSRNOT00000100069
RGD ID: 13692498 Promoter ID: EPDNEW_R3023 Type: initiation region Name: Napb_1 Description: NSF attachment protein beta SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 3 143,063,935 - 143,063,995 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-05
Napb
N-ethylmaleimide sensitive fusion protein attachment protein beta
LOC499903
similar to N-ethylmaleimide sensitive fusion protein attachment protein beta
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-11-19
LOC499903
similar to N-ethylmaleimide sensitive fusion protein attachment protein beta
Symbol and Name status set to provisional
70820 PROVISIONAL
