Snapc5 (small nuclear RNA activating complex, polypeptide 5) - Rat Genome Database

Snapc5 (small nuclear RNA activating complex, polypeptide 5) - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Gene: Snapc5 (small nuclear RNA activating complex, polypeptide 5) Rattus norvegicus

Subscribe to Updates

Symbol:

Snapc5

Name:

small nuclear RNA activating complex, polypeptide 5

RGD ID:

1582813

Description:

Predicted to enable RNA polymerase II general transcription initiation factor activity and RNA polymerase III general transcription initiation factor activity. Predicted to be involved in snRNA transcription by RNA polymerase II and snRNA transcription by RNA polymerase III. Predicted to be located in nuclear body and nucleolus. Orthologous to human SNAPC5 (small nuclear RNA activating complex polypeptide 5); PARTICIPATES IN RNA polymerase III transcription pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil; acrylamide.

Type:

protein-coding (Ensembl: lncRNA)

RefSeq Status:

Previously known as:

LOC691501; similar to small nuclear RNA activating complex, polypeptide 5; snRNA-activating protein complex subunit 5

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	8	73,572,503 - 73,576,068 (+)	NCBI		GRCr8
mRatBN7.2	8	64,677,204 - 64,680,769 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	8	64,677,205 - 64,681,964 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	8	70,192,038 - 70,195,602 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	8	68,464,629 - 68,468,193 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	8	66,334,616 - 66,338,180 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	8	69,127,708 - 69,131,539 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	69,127,708 - 69,131,539 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	8	68,833,944 - 68,837,775 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	8	68,372,827 - 68,375,880 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	8	64,083,944 - 64,087,509 (+)	NCBI		Celera
Cytogenetic Map	8	q24	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	Bloom syndrome		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Bloom syndrome	ClinVar	PMID:28492532
Snapc5	Rat	cardiofaciocutaneous syndrome		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Cardio-facio-cutaneous syndrome	ClinVar
Snapc5	Rat	cardiofaciocutaneous syndrome 3		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar more ...	ClinVar	PMID:24033266 more ...
Snapc5	Rat	colorectal cancer		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Familial colorectal cancer	ClinVar	PMID:28492532
Snapc5	Rat	long QT syndrome		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Long QT syndrome	ClinVar	PMID:26132555
Snapc5	Rat	melorheostosis		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Melorheostosis	ClinVar	PMID:25741868 and PMID:28492532
Snapc5	Rat	neuronal ceroid lipofuscinosis		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Neuronal ceroid lipofuscinosis	ClinVar	PMID:28492532
Snapc5	Rat	Noonan syndrome		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: Noonan syndrome	ClinVar	PMID:28492532
Snapc5	Rat	RASopathy		ISO	SNAPC5 (Homo sapiens)	8554872	ClinVar Annotator: match by term: RASopathy	ClinVar	PMID:16199547 more ...

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	1,2-dimethylhydrazine	multiple interactions	ISO	Snapc5 (Mus musculus)	6480464	[1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of SNAPC5 mRNA	CTD	PMID:22206623
Snapc5	Rat	1,2-dimethylhydrazine	decreases expression	ISO	Snapc5 (Mus musculus)	6480464	1 and 2-Dimethylhydrazine results in decreased expression of SNAPC5 mRNA	CTD	PMID:22206623
Snapc5	Rat	17beta-estradiol	increases expression	ISO	Snapc5 (Mus musculus)	6480464	Estradiol results in increased expression of SNAPC5 mRNA	CTD	PMID:39298647
Snapc5	Rat	2,2',4,4'-Tetrabromodiphenyl ether	affects expression	ISO	Snapc5 (Mus musculus)	6480464	2 more ...	CTD	PMID:30294300
Snapc5	Rat	2,3',4,4',5-Pentachlorobiphenyl	increases expression	ISO	Snapc5 (Mus musculus)	6480464	2 more ...	CTD	PMID:31388691
Snapc5	Rat	2,3,7,8-tetrachlorodibenzodioxine	affects expression	EXP		6480464	Tetrachlorodibenzodioxin affects the expression of SNAPC5 mRNA	CTD	PMID:22298810
Snapc5	Rat	2,3,7,8-tetrachlorodibenzodioxine	decreases expression	EXP		6480464	Tetrachlorodibenzodioxin results in decreased expression of SNAPC5 mRNA	CTD	PMID:33387578
Snapc5	Rat	2,3,7,8-tetrachlorodibenzodioxine	affects expression	ISO	Snapc5 (Mus musculus)	6480464	Tetrachlorodibenzodioxin affects the expression of SNAPC5 mRNA	CTD	PMID:21570461 and PMID:24680724
Snapc5	Rat	3-isobutyl-1-methyl-7H-xanthine	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of SNAPC5 mRNA	CTD	PMID:28628672
Snapc5	Rat	4,4'-diaminodiphenylmethane	affects expression	ISO	Snapc5 (Mus musculus)	6480464	4 and 4'-diaminodiphenylmethane affects the expression of SNAPC5 mRNA	CTD	PMID:18648102
Snapc5	Rat	4,4'-sulfonyldiphenol	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of SNAPC5 mRNA	CTD	PMID:28628672
Snapc5	Rat	4,4'-sulfonyldiphenol	increases expression	ISO	Snapc5 (Mus musculus)	6480464	bisphenol S results in increased expression of SNAPC5 mRNA	CTD	PMID:39298647
Snapc5	Rat	4-hydroxynon-2-enal	increases expression	ISO	Snapc5 (Mus musculus)	6480464	4-hydroxy-2-nonenal results in increased expression of SNAPC5 mRNA	CTD	PMID:19191707
Snapc5	Rat	6-propyl-2-thiouracil	decreases expression	EXP		6480464	Propylthiouracil results in decreased expression of SNAPC5 mRNA	CTD	PMID:24780913
Snapc5	Rat	acrylamide	increases expression	EXP		6480464	Acrylamide results in increased expression of SNAPC5 mRNA	CTD	PMID:28959563
Snapc5	Rat	aristolochic acid A	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	aristolochic acid I results in decreased expression of SNAPC5 mRNA	CTD	PMID:33212167
Snapc5	Rat	arsenous acid	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Arsenic Trioxide results in decreased expression of SNAPC5 mRNA	CTD	PMID:20458559
Snapc5	Rat	bisphenol A	increases expression	ISO	Snapc5 (Mus musculus)	6480464	bisphenol A results in increased expression of SNAPC5 mRNA	CTD	PMID:26063408
Snapc5	Rat	bisphenol A	increases expression	EXP		6480464	bisphenol A results in increased expression of SNAPC5 mRNA	CTD	PMID:31129395
Snapc5	Rat	bisphenol A	affects methylation	ISO	Snapc5 (Mus musculus)	6480464	bisphenol A affects the methylation of SNAPC5 promoter	CTD	PMID:27334623
Snapc5	Rat	bisphenol A	decreases expression	EXP		6480464	bisphenol A results in decreased expression of SNAPC5 mRNA	CTD	PMID:25181051
Snapc5	Rat	butanal	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	butyraldehyde results in decreased expression of SNAPC5 mRNA	CTD	PMID:26079696
Snapc5	Rat	cadmium dichloride	increases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Cadmium Chloride results in increased expression of SNAPC5 mRNA	CTD	PMID:26472689
Snapc5	Rat	copper(II) sulfate	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Copper Sulfate results in decreased expression of SNAPC5 mRNA	CTD	PMID:19549813
Snapc5	Rat	dexamethasone	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of SNAPC5 mRNA	CTD	PMID:28628672
Snapc5	Rat	diarsenic trioxide	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Arsenic Trioxide results in decreased expression of SNAPC5 mRNA	CTD	PMID:20458559
Snapc5	Rat	Dibutyl phosphate	affects expression	ISO	SNAPC5 (Homo sapiens)	6480464	di-n-butylphosphoric acid affects the expression of SNAPC5 mRNA	CTD	PMID:37042841
Snapc5	Rat	endosulfan	decreases expression	EXP		6480464	Endosulfan results in decreased expression of SNAPC5 mRNA	CTD	PMID:29391264
Snapc5	Rat	folic acid	multiple interactions	ISO	Snapc5 (Mus musculus)	6480464	[1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of SNAPC5 mRNA	CTD	PMID:22206623
Snapc5	Rat	gentamycin	decreases expression	EXP		6480464	Gentamicins results in decreased expression of SNAPC5 mRNA	CTD	PMID:33387578
Snapc5	Rat	indometacin	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in increased expression of SNAPC5 mRNA	CTD	PMID:28628672
Snapc5	Rat	nitrates	multiple interactions	ISO	Snapc5 (Mus musculus)	6480464	[Particulate Matter results in increased abundance of Nitrates] which results in increased expression of SNAPC5 mRNA	CTD	PMID:35964746
Snapc5	Rat	ozone	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[Air Pollutants results in increased abundance of Ozone] which affects the expression of SNAPC5 mRNA	CTD	PMID:35430440
Snapc5	Rat	paracetamol	affects expression	ISO	Snapc5 (Mus musculus)	6480464	Acetaminophen affects the expression of SNAPC5 mRNA	CTD	PMID:17562736
Snapc5	Rat	pentanal	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	pentanal results in decreased expression of SNAPC5 mRNA	CTD	PMID:26079696
Snapc5	Rat	resveratrol	multiple interactions	ISO	SNAPC5 (Homo sapiens)	6480464	[Plant Extracts co-treated with Resveratrol] results in increased expression of SNAPC5 mRNA	CTD	PMID:23557933
Snapc5	Rat	silicon dioxide	decreases methylation	ISO	SNAPC5 (Homo sapiens)	6480464	Silicon Dioxide results in decreased methylation of SNAPC5 gene	CTD	PMID:34973136
Snapc5	Rat	sodium arsenite	increases expression	ISO	SNAPC5 (Homo sapiens)	6480464	sodium arsenite results in increased expression of SNAPC5 mRNA	CTD	PMID:17879257
Snapc5	Rat	Soman	decreases expression	EXP		6480464	Soman results in decreased expression of SNAPC5 mRNA	CTD	PMID:19281266
Snapc5	Rat	sunitinib	increases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Sunitinib results in increased expression of SNAPC5 mRNA	CTD	PMID:31533062
Snapc5	Rat	taurine	increases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Taurine results in increased expression of SNAPC5 mRNA	CTD	PMID:16579726
Snapc5	Rat	thioacetamide	increases methylation	EXP		6480464	Thioacetamide results in increased methylation of SNAPC5 promoter	CTD	PMID:27914986
Snapc5	Rat	titanium dioxide	decreases expression	ISO	Snapc5 (Mus musculus)	6480464	titanium dioxide results in decreased expression of SNAPC5 mRNA	CTD	PMID:23557971
Snapc5	Rat	titanium dioxide	decreases methylation	ISO	Snapc5 (Mus musculus)	6480464	titanium dioxide results in decreased methylation of SNAPC5 gene	CTD	PMID:35295148
Snapc5	Rat	trichostatin A	affects expression	ISO	SNAPC5 (Homo sapiens)	6480464	trichostatin A affects the expression of SNAPC5 mRNA	CTD	PMID:28542535
Snapc5	Rat	valproic acid	decreases expression	ISO	SNAPC5 (Homo sapiens)	6480464	Valproic Acid results in decreased expression of SNAPC5 mRNA	CTD	PMID:23179753
Snapc5	Rat	vinclozolin	affects expression	EXP		6480464	vinclozolin affects the expression of SNAPC5 mRNA	CTD	PMID:19015723

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	snRNA transcription by RNA polymerase II	involved_in	ISO	SNAPC5 (Homo sapiens)	1624291	PMID:9732265	RGD	PMID:9732265
Snapc5	Rat	snRNA transcription by RNA polymerase III	involved_in	ISO	SNAPC5 (Homo sapiens)	1624291	PMID:9732265	RGD	PMID:9732265

Cellular Component

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	nuclear body	located_in	ISO	SNAPC5 (Homo sapiens) and UniProtKB:O75971-1	1624291		RGD	GO_REF:0000052
Snapc5	Rat	nucleolus	located_in	ISO	SNAPC5 (Homo sapiens) and UniProtKB:O75971-1	1624291		RGD	GO_REF:0000052
Snapc5	Rat	nucleoplasm	located_in	ISO	SNAPC5 (Homo sapiens) and UniProtKB:O75971-1	1624291		RGD	GO_REF:0000052

Molecular Function

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	protein binding	enables	ISO	SNAPC5 (Homo sapiens)	1624291	UniProtKB:O60232 more ...	RGD	PMID:11056176 more ...
Snapc5	Rat	protein binding	enables	ISO	SNAPC5 (Homo sapiens) and UniProtKB:O75971-2	1624291	UniProtKB:A0A1B0GWI1 more ...	RGD	PMID:32296183
Snapc5	Rat	RNA polymerase II general transcription initiation factor activity	enables	ISO	SNAPC5 (Homo sapiens)	1624291	PMID:9732265	RGD	PMID:9732265
Snapc5	Rat	RNA polymerase III general transcription initiation factor activity	enables	ISO	SNAPC5 (Homo sapiens)	1624291	PMID:9732265	RGD	PMID:9732265

RGD Manual Annotations

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
Snapc5	Rat	RNA polymerase III transcription pathway		ISO	SNAPC5 (Homo sapiens)	9588284		RGD

#	Reference Title	Reference Citation
1.	Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.	Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
3.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions
4.	A structural perspective on RNA polymerase I and RNA polymerase III transcription machineries.	Vannini A Biochim Biophys Acta. 2013 Mar-Apr;1829(3-4):258-64. doi: 10.1016/j.bbagrm.2012.09.009. Epub 2012 Sep 29.

PMID:8889548	PMID:9732265

Snapc5
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	8	73,572,503 - 73,576,068 (+)	NCBI		GRCr8
mRatBN7.2	8	64,677,204 - 64,680,769 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	8	64,677,205 - 64,681,964 (+)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	8	70,192,038 - 70,195,602 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	8	68,464,629 - 68,468,193 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	8	66,334,616 - 66,338,180 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	8	69,127,708 - 69,131,539 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	8	69,127,708 - 69,131,539 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	8	68,833,944 - 68,837,775 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	8	68,372,827 - 68,375,880 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	8	64,083,944 - 64,087,509 (+)	NCBI		Celera
Cytogenetic Map	8	q24	NCBI

SNAPC5
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	15	66,489,748 - 66,497,762 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	15	66,490,135 - 66,497,780 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	15	66,782,086 - 66,790,100 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	15	64,569,720 - 64,577,200 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	15	64,573,827 - 64,577,123	NCBI
Celera	15	43,671,873 - 43,679,351 (-)	NCBI		Celera
Cytogenetic Map	15	q22.31	NCBI
HuRef	15	43,618,786 - 43,626,283 (-)	NCBI		HuRef
CHM1_1	15	66,900,682 - 66,908,152 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	15	64,311,223 - 64,319,236 (-)	NCBI		T2T-CHM13v2.0

Snapc5
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	9	64,086,066 - 64,089,972 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	9	64,086,556 - 64,090,414 (+)	Ensembl		GRCm39 Ensembl
GRCm38	9	64,179,297 - 64,182,688 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	9	64,179,274 - 64,183,132 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	9	64,027,104 - 64,030,495 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	9	63,977,314 - 63,980,694 (+)	NCBI		MGSCv36	mm8
Celera	9	61,404,590 - 61,407,981 (+)	NCBI		Celera
Cytogenetic Map	9	C	NCBI
cM Map	9	34.54	NCBI

Snapc5
(Chinchilla lanigera - long-tailed chinchilla)

Chinchilla Assembly	Chr	Position (strand)	Source	Genome Browsers
Chinchilla Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChiLan1.0 Ensembl	NW_004955450	9,176,462 - 9,197,592 (+)	Ensembl	ChiLan1.0
ChiLan1.0	NW_004955450	9,176,462 - 9,197,592 (+)	NCBI	ChiLan1.0	ChiLan1.0

SNAPC5
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	16	55,742,209 - 55,750,944 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	15	59,918,539 - 59,924,395 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	15	45,440,597 - 45,446,007 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	15	63,712,363 - 63,720,420 (-)	NCBI	panpan1.1	PanPan1.1	panPan2
PanPan1.1 Ensembl	15	63,712,363 - 63,720,420 (-)	Ensembl	panpan1.1		panPan2

SNAPC5
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	30	30,759,501 - 30,765,484 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	30	30,759,501 - 30,765,445 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	30	30,689,157 - 30,695,601 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	30	30,955,647 - 30,962,091 (-)	NCBI		ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	30	30,954,138 - 30,962,075 (-)	Ensembl		ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	30	30,885,049 - 30,891,545 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	30	30,944,431 - 30,951,094 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	30	31,186,078 - 31,192,524 (-)	NCBI		UU_Cfam_GSD_1.0

Snapc5
(Ictidomys tridecemlineatus - thirteen-lined ground squirrel)

Squirrel Assembly	Chr	Position (strand)	Source	Genome Browsers
Squirrel Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HiC_Itri_2	NW_024408640	108,782,461 - 108,786,592 (-)	NCBI		HiC_Itri_2
SpeTri2.0 Ensembl	NW_004936471	26,627,778 - 26,634,763 (-)	Ensembl	SpeTri2.0	SpeTri2.0 Ensembl
SpeTri2.0	NW_004936471	26,629,765 - 26,634,640 (-)	NCBI	SpeTri2.0	SpeTri2.0		SpeTri2.0

SNAPC5
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	1	164,467,599 - 164,475,011 (-)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	1	164,459,111 - 164,475,053 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	1	182,181,550 - 182,189,349 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

SNAPC5
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	26	17,052,898 - 17,056,839 (+)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
ChlSab1.1 Ensembl	26	17,052,976 - 17,056,245 (+)	Ensembl	ChlSab1.1	ChlSab1.1 Ensembl	chlSab2
Vero_WHO_p1.0	NW_023666048	124,392,625 - 124,399,376 (-)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Snapc5
(Heterocephalus glaber - naked mole-rat)

Naked Mole-Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Naked Mole-Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
HetGla_female_1.0 Ensembl	NW_004624781	6,216,277 - 6,222,282 (+)	Ensembl	HetGla_female_1.0	HetGla_female_1.0 Ensembl	hetGla2
HetGla 1.0	NW_004624781	6,216,255 - 6,222,439 (+)	NCBI	HetGla_female_1.0	HetGla 1.0	hetGla2

.

Variants in Snapc5
5 total Variants

Predicted Target Of

	Summary Value
Count of predictions:	86
Count of miRNA genes:	77
Interacting mature miRNAs:	79
Transcripts:	ENSRNOT00000013490
Prediction methods:	Miranda, Rnahybrid
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1298065	Scl16	Serum cholesterol level QTL 16	3.8		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	8	30856404	75856404	Rat
1554321	Bmd3	Bone mineral density QTL 3	7.9	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	8	40952565	123900184	Rat
1578769	Uae31	Urinary albumin excretion QTL 31	3.3	0.001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	8	30848154	101699754	Rat
1298079	Activ2	Activity QTL 2	9.5	0.000001	voluntary movement trait (VT:0003491)	rearing measurement (CMO:0001515)	8	41866876	86866876	Rat
70161	Bp62	Blood pressure QTL 62	2.9	0.001	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	42692684	90165460	Rat
1578765	Klgr1	Kidney lesion grade QTL 1	3.3	0.0001	kidney morphology trait (VT:0002135)	organ lesion measurement (CMO:0000677)	8	30848154	101699754	Rat
1582222	Epfw2	Epididymal fat weight QTL 2	3.2	0.0005	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	8	31737729	76737729	Rat
61464	Niddm11	Non-insulin dependent diabetes mellitus QTL 11	3.1	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	8	35582032	80582032	Rat
4889938	Bss89	Bone structure and strength QTL 89	3.8		tibia size trait (VT:0100001)	tibia cortical bone volume (CMO:0001725)	8	50095249	82460899	Rat
1578755	Pur5	Proteinuria QTL 5	3.3	0.0001	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	8	30848154	101699754	Rat
1300146	Rf17	Renal function QTL 17	2.9		renal blood flow trait (VT:2000006)	absolute change in renal blood flow rate (CMO:0001168)	8	28242912	73242912	Rat
8662823	Vetf5	Vascular elastic tissue fragility QTL 5	1.9		artery integrity trait (VT:0010639)	patent ductus arteriosus score (CMO:0002566)	8	28242912	99525068	Rat
2313088	Bss75	Bone structure and strength QTL 75	3.1	0.0001	body length (VT:0001256)	body length, nose to rump (CMO:0000079)	8	30848154	82460899	Rat
1358896	Bp262	Blood pressure QTL 262	2.89		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	8	27205715	99103503	Rat
731182	Uae24	Urinary albumin excretion QTL 24	6.4		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	8	19331152	93965294	Rat
724514	Uae15	Urinary albumin excretion QTL 15	2.9		urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	8	29502665	70386295	Rat
631842	Inf1	Infertility severity QTL 1	4.1	0.001	seminal gland mass (VT:0010524)	seminal vesicle wet weight (CMO:0001603)	8	22662330	67662330	Rat
737824	Hcar10	Hepatocarcinoma resistance QTL 10	2.9		liver integrity trait (VT:0010547)	liver tumorous lesion number (CMO:0001068)	8	40713066	82925667	Rat
1331769	Rf39	Renal function QTL 39	3.871		urine output (VT:0003620)	timed urine volume (CMO:0000260)	8	41866876	75097878	Rat
61358	Bp39	Blood pressure QTL 39	2		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	35551938	80551938	Rat
1358906	Bp253	Blood pressure QTL 253	4	0.0004	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	8	40713066	93965294	Rat
1358907	Cm40	Cardiac mass QTL 40	1.89		heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	8	27205715	99103503	Rat
70197	BpQTLcluster8	Blood pressure QTL cluster 8	3.482		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	46531639	119088626	Rat
2316950	Scl66	Serum cholesterol level QTL 66	4.1		blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	8	30848259	105647037	Rat
1582254	Kidm31	Kidney mass QTL 31	3		kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	8	54237644	85365202	Rat
10402857	Bp380	Blood pressure QTL 380		0.95	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	8	53968765	98968765	Rat
1358892	Kidm26	Kidney mass QTL 26	3.69		kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	8	27205715	99103503	Rat
631216	Stl9	Serum triglyceride level QTL 9	4.71	0.0001	blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	8	41867010	70386132	Rat
5684973	Bss100	Bone structure and strength QTL 100	4.7		tibia area (VT:1000281)	tibia area measurement (CMO:0001382)	8	50095249	82460899	Rat
1582243	Bw66	Body weight QTL 66	3.4	0.0048	body mass (VT:0001259)	body weight (CMO:0000012)	8	54237644	85365202	Rat
2313057	Bss76	Bone structure and strength QTL 76	3	0.0001	tibia size trait (VT:0100001)	tibia midshaft cross-sectional area (CMO:0001717)	8	30848154	82460899	Rat
12879878	Bw183	Body weight QTL 183		0.001	body mass (VT:0001259)	body weight (CMO:0000012)	8	43296169	98968765	Rat
1300177	Cm2	Cardiac mass QTL 2	3.65		heart mass (VT:0007028)	heart weight (CMO:0000017)	8	54259986	100382532	Rat
1549908	Neudeg1	Neurodegradation QTL 1	5.5	0	nervous system integrity trait (VT:0010566)	logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986)	8	30188867	94457446	Rat
12879879	Cm99	Cardiac mass QTL 99		0.001	heart mass (VT:0007028)	heart weight to body weight ratio (CMO:0000074)	8	43296169	98968765	Rat
2313067	Bss77	Bone structure and strength QTL 77	3.1	0.0001	tibia size trait (VT:0100001)	tibia midshaft endosteal cross-sectional area (CMO:0001716)	8	30848154	82460899	Rat
12879880	Cm100	Cardiac mass QTL 100		0.001	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	8	43296169	98968765	Rat
12879881	Cm101	Cardiac mass QTL 101		0.001	heart right ventricle mass (VT:0007033)	heart right ventricle weight to body weight ratio (CMO:0000914)	8	43296169	98968765	Rat
12879882	Am8	Aortic mass QTL 8		0.001	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	8	43296169	98968765	Rat
12879883	Kidm65	Kidney mass QTL 65		0.001	kidney mass (VT:0002707)	both kidneys wet weight to body weight ratio (CMO:0000340)	8	43296169	98968765	Rat
1358912	Bw51	Body weight QTL 51	2.95		body mass (VT:0001259)	body weight (CMO:0000012)	8	51351728	107062046	Rat
2313086	Bss60	Bone structure and strength QTL 60	4.1	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	8	50095249	82460899	Rat
2303171	Bp331	Blood pressure QTL 331	5.57	0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	8	61290298	119084929	Rat
2293697	Bmd39	Bone mineral density QTL 39			femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	8	54043744	98968765	Rat
1331837	Bw23	Body weight QTL 23	4.19	0.00007	body mass (VT:0001259)	body weight (CMO:0000012)	8	46531722	99083736	Rat
1331838	Niddm61	Non-insulin dependent diabetes mellitus QTL 61	3.53	0.0004	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	8	36469535	99083736	Rat
631650	Stl6	Serum triglyceride level QTL 6	4	0.0019	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	8	10378157	112202585	Rat
1581557	Eae16	Experimental allergic encephalomyelitis QTL 16	3.8		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	8	8462195	110921472	Rat
631271	Lecl1	Lens clarity QTL 1		0.001	lens clarity trait (VT:0001304)	age of onset/diagnosis of cataract (CMO:0001584)	8	18984168	84531599	Rat
2303564	Gluco43	Glucose level QTL 43	3		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	8	26130187	71130187	Rat
2303570	Gluco48	Glucose level QTL 48	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	8	49805831	94805831	Rat
2313046	Bss78	Bone structure and strength QTL 78	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	8	30848154	82460899	Rat
2303572	Insul13	Insulin level QTL 13	2		blood insulin amount (VT:0001560)	blood insulin level (CMO:0000349)	8	26130187	71130187	Rat
2301402	Bp316	Blood pressure QTL 316		0.005	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	8	53968765	98968765	Rat
631664	Hcar3	Hepatocarcinoma resistance QTL 3	2.9	0.0005	liver integrity trait (VT:0010547)	volume of individual liver tumorous lesion (CMO:0001078)	8	54237644	99103503	Rat

RH138294

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	8	64,680,588 - 64,680,712 (+)	MAPPER	mRatBN7.2
Rnor_6.0	8	69,131,359 - 69,131,482	NCBI	Rnor6.0
Rnor_5.0	8	68,837,595 - 68,837,718	UniSTS	Rnor5.0
RGSC_v3.4	8	68,376,213 - 68,376,336	UniSTS	RGSC3.4
Celera	8	64,087,329 - 64,087,452	UniSTS
RH 3.4 Map	8	811.3	UniSTS
Cytogenetic Map	8	q24	UniSTS

BE114791

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	8	64,679,849 - 64,680,018 (+)	MAPPER	mRatBN7.2
Rnor_6.0	8	69,130,620 - 69,130,788	NCBI	Rnor6.0
Rnor_5.0	8	68,836,856 - 68,837,024	UniSTS	Rnor5.0
RGSC_v3.4	8	68,375,474 - 68,375,642	UniSTS	RGSC3.4
Celera	8	64,086,590 - 64,086,758	UniSTS
RH 3.4 Map	8	804.6	UniSTS
Cytogenetic Map	8	q24	UniSTS

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
9	11	49	113	91	90	59	25	59	6	218	97	93	45	60	31


RefSeq Transcripts	NM_001109643	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BQ779749	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BQ780006	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH473975	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	EV775546	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000008	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000013490 ⟹ ENSRNOP00000013490

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	8	64,677,205 - 64,681,826 (+)	Ensembl
Rnor_6.0 Ensembl	8	69,127,708 - 69,131,539 (+)	Ensembl

Ensembl Acc Id:

ENSRNOT00000106936

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
mRatBN7.2 Ensembl	8	64,678,205 - 64,681,964 (+)	Ensembl

RefSeq Acc Id:

NM_001109643 ⟹ NP_001103113

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	8	73,572,503 - 73,576,068 (+)	NCBI
mRatBN7.2	8	64,677,204 - 64,680,769 (+)	NCBI
Rnor_6.0	8	69,127,708 - 69,131,539 (+)	NCBI
Rnor_5.0	8	68,833,944 - 68,837,775 (+)	NCBI
RGSC_v3.4	8	68,372,827 - 68,375,880 (+)	RGD
Celera	8	64,083,944 - 64,087,509 (+)	NCBI

Sequence:

show sequence

CGCTTTACGGGAGTGGAGGAGCATGTTGAGTCGGTTGCAGGAGCTCCGCAAGGAGGAAGAGACCCTGCTGCGTCTAAAGGCAGCCCTGCATGACCAACTGAACCGTCTCAAGGTCGAAGAATTGGCCC
TTCAATCAATGATAAATTCTCGAGGACGGACTGAGACACTGCCTTCTCAGCCTGCACCTGAACAGTTATGTGATATGTCGCTGCAGGTGGACAATGAAGCATCAATCAATCAAACTGCACTGAAGCTG
AGCACAAGGAGCCCAATGGAGGAGGAGGAGGAGGAAGAAGAAGAGGAGGAAGAATCTGATTCGTGAAGGGGACAAGGGCTAGGGTTAGTTATACAAACTAAACTAAGTCTTCGGTACTTCATCTCTTC
AAAGTCGTCTTGCAGGGCCTATGTGAGAGATATACTTATAAATGGAAGAGGCTCAGTCCATAAAGTATCTACATGCAAATACGAAGACCTGAGTTTGGAGCCCCAGAATCTGTGTAAAAACCTAGGCA
GAGTGTCGAGTGCCTGTAACCCCAGCACTGGAGATAGGAAGACCAACAGATCTCTGAAGCACACTGGCCAGCCTCATCTAGCCAAAACCAGTGAGTTCCGGTTTACTCAGAGACCCCGTCTGGAGAGC
AGTGGTGGTGCTCATAGAGGCACACATCTCAATCCCAGCACATATGTATGGAAAGGGTTAAATAACTGCAAAAAAAATGGTTCTTTTCTACCGAGATCTATAAATCAGTTCAATCTCACTACTAGAGG
AATGGGGGAAAGTAGATAACATCTGATCATTAGGTAGAAGATCATAGTAAGACACAGTGTGAGCTAACTTTGGCATTTACACACCTGTAATCCCAGGCTTTAGGATGCTCTAGCAAGAGTGACCGCCA
TCCACTGTGAAGCCAACTTGAACTATAACCAAACCAAAACAGTGCCAGGTCTTACCAGGGGTCAGTCACAGGGATGTGACAGGGGAGGCAAAGGTAGGATATCAGGTCAGTGTGATAGTCCACAAAGC
AAGTTCAACAGCCATACTCCGTACAGAAAACTGCCAGCAACCTCTGGCCATCAGCACGCCTCCTCAACACACCAAGTACGTCATATACACCCCCATGCTGACAACTCCCTACACAATATCTACACTGG
TTTTGTGTAAGATGTTCTTCCAAAGAAGAAACCGAGGAATATCAAAAAAAAAAAAAAAAAA

hide sequence


Protein RefSeqs	NP_001103113	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	EDL95790	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00000099664

RefSeq Acc Id:	NP_001103113 ⟸ NM_001109643
- UniProtKB:	A6J5B7 (UniProtKB/TrEMBL)
- Sequence:	show sequence MLSRLQELRKEEETLLRLKAALHDQLNRLKVEELALQSMINSRGRTETLPSQPAPEQLCDMSLQVDNEASINQTALKLSTRSPMEEEEEEEEEEEESDS hide sequence

Ensembl Acc Id:

ENSRNOP00000013490 ⟸ ENSRNOT00000013490

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-D3ZTK9-F1-model_v2	AlphaFold	D3ZTK9	1-99	view protein structure

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

RGD ID:

Promoter ID:

Type:

multiple initiation site

Name:

Snapc5_1

Description:

small nuclear RNA activating complex, polypeptide 5

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	8	69,127,699 - 69,127,759	EPDNEW

Database	Acc Id	Source(s)
BioCyc Gene	G2FUF-30105	BioCyc
Ensembl Genes	ENSRNOG00000010156	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000013490	ENTREZGENE
InterPro	SNAPC5	UniProtKB/TrEMBL
KEGG Report	rno:691501	UniProtKB/TrEMBL
NCBI Gene	691501	ENTREZGENE
PANTHER	SNRNA-ACTIVATING PROTEIN COMPLEX SUBUNIT 5	UniProtKB/TrEMBL
	SNRNA-ACTIVATING PROTEIN COMPLEX SUBUNIT 5	UniProtKB/TrEMBL
Pfam	SNAPC5	UniProtKB/TrEMBL
PhenoGen	Snapc5	PhenoGen
RatGTEx	ENSRNOG00000010156	RatGTEx
RNAcentral	URS00022B0CD1	RNACentral
	URS00022B68D1	RNACentral
UniProt	A6J5B7	ENTREZGENE, UniProtKB/TrEMBL

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2008-03-06	Snapc5	small nuclear RNA activating complex, polypeptide 5	LOC691501	similar to small nuclear RNA activating complex, polypeptide 5	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2008-01-09	LOC691501	similar to small nuclear RNA activating complex, polypeptide 5	LOC686858	similar to small nuclear RNA activating complex, polypeptide 5	Data merged from RGD:1592493	1643240	APPROVED
2006-11-20	LOC686858	similar to small nuclear RNA activating complex, polypeptide 5			Symbol and Name status set to provisional	70820	PROVISIONAL
2006-11-19	LOC691501	similar to small nuclear RNA activating complex, polypeptide 5			Symbol and Name status set to provisional	70820	PROVISIONAL