Symbol:
Jcad
Name:
junctional cadherin 5 associated
RGD ID:
1562037
Description:
Predicted to be involved in several processes, including positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis; positive regulation of cell migration involved in sprouting angiogenesis; and positive regulation of signal transduction. Predicted to be located in cell-cell junction and perinuclear region of cytoplasm. Predicted to be active in adherens junction and ruffle membrane. Orthologous to human JCAD (junctional cadherin 5 associated); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 6-propyl-2-thiouracil.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
junctional protein associated with coronary artery disease; LOC498764; RGD1562037; similar to OTTHUMP00000046255
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 57,784,634 - 57,826,213 (-) NCBI GRCr8 mRatBN7.2 17 53,089,382 - 53,130,996 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 53,089,382 - 53,130,967 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 17 55,667,754 - 55,709,738 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 55,670,331 - 55,709,740 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 53,350,740 - 53,392,719 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 17 61,352,776 - 61,391,912 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 17 49,091,895 - 49,133,491 (-) NCBI Celera Cytogenetic Map 17 q12.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Jcad Rat 1,2-dimethylhydrazine multiple interactions ISO RGD:1312319 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of JCAD mRNA CTD PMID:22206623 Jcad Rat 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of JCAD mRNA CTD PMID:26496021 Jcad Rat 17beta-estradiol increases expression ISO RGD:1346091 6480464 Estradiol results in increased expression of JCAD mRNA CTD PMID:31614463 Jcad Rat 17beta-estradiol affects expression EXP 6480464 Estradiol affects the expression of JCAD mRNA CTD PMID:32145629 Jcad Rat 17beta-estradiol multiple interactions ISO RGD:1346091 6480464 [Estradiol co-treated with TGFB1 protein] results in increased expression of JCAD mRNA CTD PMID:30165855 Jcad Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO RGD:1346091 6480464 Tetrachlorodibenzodioxin results in increased expression of JCAD mRNA CTD PMID:19684285 Jcad Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of JCAD mRNA CTD PMID:21215274|PMID:33387578 Jcad Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO RGD:1346091 6480464 Tetrachlorodibenzodioxin results in decreased expression of JCAD mRNA CTD PMID:19684285 Jcad Rat 3-Nitrobenzanthrone increases expression ISO RGD:1346091 6480464 3-nitrobenzanthrone results in increased expression of JCAD mRNA CTD PMID:34036453 Jcad Rat 4,4'-sulfonyldiphenol increases expression ISO RGD:1312319 6480464 bisphenol S results in increased expression of JCAD mRNA CTD PMID:30951980 Jcad Rat 4-hydroxyphenyl retinamide increases expression ISO RGD:1312319 6480464 Fenretinide results in increased expression of JCAD mRNA CTD PMID:28973697 Jcad Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of JCAD mRNA CTD PMID:24780913 Jcad Rat aflatoxin B1 affects expression ISO RGD:1346091 6480464 Aflatoxin B1 affects the expression of JCAD protein CTD PMID:20106945 Jcad Rat aflatoxin B1 increases methylation ISO RGD:1346091 6480464 Aflatoxin B1 results in increased methylation of JCAD intron CTD PMID:30157460 Jcad Rat aflatoxin B1 increases expression ISO RGD:1346091 6480464 Aflatoxin B1 results in increased expression of JCAD mRNA CTD PMID:22100608 Jcad Rat all-trans-retinoic acid decreases expression ISO RGD:1346091 6480464 Tretinoin results in decreased expression of JCAD mRNA CTD PMID:21934132 Jcad Rat aristolochic acid A increases expression ISO RGD:1346091 6480464 aristolochic acid I results in increased expression of JCAD mRNA CTD PMID:33212167 Jcad Rat arsane affects methylation ISO RGD:1346091 6480464 Arsenic affects the methylation of JCAD gene CTD PMID:25304211 Jcad Rat arsenic atom affects methylation ISO RGD:1346091 6480464 Arsenic affects the methylation of JCAD gene CTD PMID:25304211 Jcad Rat benzo[a]pyrene decreases methylation ISO RGD:1346091 6480464 Benzo(a)pyrene results in decreased methylation of JCAD 3' UTR CTD PMID:27901495 Jcad Rat benzo[a]pyrene increases expression ISO RGD:1346091 6480464 Benzo(a)pyrene results in increased expression of JCAD mRNA CTD PMID:32234424 Jcad Rat benzo[a]pyrene affects methylation ISO RGD:1346091 6480464 Benzo(a)pyrene affects the methylation of JCAD 5' UTR; Benzo(a)pyrene affects the methylation of JCAD promoter CTD PMID:27901495 Jcad Rat benzo[a]pyrene increases expression ISO RGD:1312319 6480464 Benzo(a)pyrene results in increased expression of JCAD mRNA CTD PMID:32417428 Jcad Rat bis(2-ethylhexyl) phthalate increases expression ISO RGD:1346091 6480464 Diethylhexyl Phthalate results in increased expression of KIAA1462 mRNA CTD PMID:31163220 Jcad Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of JCAD mRNA CTD PMID:25181051|PMID:32145629 Jcad Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of JCAD mRNA CTD PMID:30816183|PMID:34947998|PMID:35192832|PMID:38750585 Jcad Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with Estradiol] results in decreased expression of JCAD mRNA CTD PMID:26496021 Jcad Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of JCAD mRNA CTD PMID:29097150 Jcad Rat bisphenol F increases expression ISO RGD:1312319 6480464 bisphenol F results in increased expression of JCAD mRNA CTD PMID:30951980 Jcad Rat cisplatin increases expression ISO RGD:1346091 6480464 Cisplatin results in increased expression of JCAD mRNA CTD PMID:27392435 Jcad Rat cisplatin multiple interactions ISO RGD:1346091 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of JCAD mRNA CTD PMID:27392435 Jcad Rat copper atom multiple interactions ISO RGD:1346091 6480464 [NSC 689534 binds to Copper] which results in decreased expression of JCAD mRNA CTD PMID:20971185 Jcad Rat copper(0) multiple interactions ISO RGD:1346091 6480464 [NSC 689534 binds to Copper] which results in decreased expression of JCAD mRNA CTD PMID:20971185 Jcad Rat dorsomorphin multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Jcad Rat doxorubicin decreases expression ISO RGD:1346091 6480464 Doxorubicin results in decreased expression of JCAD mRNA CTD PMID:29803840 Jcad Rat entinostat multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Jcad Rat entinostat increases expression ISO RGD:1346091 6480464 entinostat results in increased expression of JCAD mRNA CTD PMID:26272509 Jcad Rat epoxiconazole decreases expression ISO RGD:1312319 6480464 epoxiconazole results in decreased expression of JCAD mRNA CTD PMID:35436446 Jcad Rat folic acid multiple interactions ISO RGD:1312319 6480464 [1,2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of JCAD mRNA CTD PMID:22206623 Jcad Rat FR900359 increases phosphorylation ISO RGD:1346091 6480464 FR900359 results in increased phosphorylation of JCAD protein CTD PMID:37730182 Jcad Rat nickel atom decreases expression ISO RGD:1346091 6480464 Nickel results in decreased expression of JCAD mRNA CTD PMID:25583101 Jcad Rat nitrofen decreases expression EXP 6480464 nitrofen results in decreased expression of JCAD mRNA CTD PMID:33484710 Jcad Rat ozone multiple interactions ISO RGD:1312319 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in decreased more ... CTD PMID:34911549 Jcad Rat panobinostat increases expression ISO RGD:1346091 6480464 panobinostat results in increased expression of JCAD mRNA CTD PMID:26272509 Jcad Rat panobinostat multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Jcad Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of JCAD mRNA CTD PMID:33387578 Jcad Rat poly(I:C) multiple interactions EXP 6480464 [Poly I-C co-treated with HU 211] results in decreased expression of JCAD mRNA CTD PMID:26923065 Jcad Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of JCAD mRNA CTD PMID:28374803 Jcad Rat rotenone increases expression ISO RGD:1312319 6480464 Rotenone results in increased expression of JCAD mRNA CTD PMID:32937126 Jcad Rat SB 431542 multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Jcad Rat sunitinib increases expression ISO RGD:1346091 6480464 Sunitinib results in increased expression of JCAD mRNA CTD PMID:31533062 Jcad Rat trichostatin A increases expression ISO RGD:1346091 6480464 trichostatin A results in increased expression of JCAD mRNA CTD PMID:24935251|PMID:26272509 Jcad Rat trichostatin A multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Jcad Rat triphenyl phosphate affects expression EXP 6480464 triphenyl phosphate affects the expression of JCAD mRNA CTD PMID:30589522 Jcad Rat valproic acid increases expression ISO RGD:1346091 6480464 Valproic Acid results in increased expression of JCAD mRNA CTD PMID:23179753|PMID:24383497|PMID:25192806|PMID:26272509|PMID:28001369 Jcad Rat valproic acid increases methylation ISO RGD:1346091 6480464 Valproic Acid results in increased methylation of JCAD gene CTD PMID:29154799 Jcad Rat valproic acid multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased more ... CTD PMID:27188386 Jcad Rat vorinostat multiple interactions ISO RGD:1346091 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression more ... CTD PMID:27188386 Jcad Rat vorinostat increases expression ISO RGD:1346091 6480464 vorinostat results in increased expression of JCAD mRNA CTD PMID:26272509
Jcad Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 57,784,634 - 57,826,213 (-) NCBI GRCr8 mRatBN7.2 17 53,089,382 - 53,130,996 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 53,089,382 - 53,130,967 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 17 55,667,754 - 55,709,738 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 55,670,331 - 55,709,740 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 53,350,740 - 53,392,719 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 17 61,352,776 - 61,391,912 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 17 49,091,895 - 49,133,491 (-) NCBI Celera Cytogenetic Map 17 q12.1 NCBI
JCAD Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 10 30,012,803 - 30,115,494 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 10 30,012,803 - 30,115,494 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 10 30,301,732 - 30,404,423 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 10 30,343,390 - 30,376,806 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 10 30,066,704 - 30,113,471 (-) NCBI Celera Cytogenetic Map 10 p11.23 NCBI HuRef 10 30,020,289 - 30,066,873 (-) NCBI HuRef CHM1_1 10 30,301,825 - 30,348,621 (-) NCBI CHM1_1 T2T-CHM13v2.0 10 30,043,840 - 30,146,523 (-) NCBI T2T-CHM13v2.0
Jcad Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 4,590,775 - 4,682,869 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 4,634,878 - 4,682,869 (+) Ensembl GRCm39 Ensembl GRCm38 18 4,590,792 - 4,682,869 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 4,634,878 - 4,682,869 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 4,634,927 - 4,682,867 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 4,634,927 - 4,682,867 (+) NCBI MGSCv36 mm8 Celera 18 4,680,287 - 4,727,209 (+) NCBI Celera Cytogenetic Map 18 A1 NCBI cM Map 18 3.01 NCBI
Jcad Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955429 21,954,149 - 22,035,754 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955429 21,954,274 - 22,038,953 (+) NCBI ChiLan1.0 ChiLan1.0
JCAD Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 8 42,683,631 - 42,786,205 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 10 42,688,961 - 42,791,531 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 10 30,163,932 - 30,266,266 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 10 30,519,256 - 30,553,925 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 10 30,528,772 - 30,553,865 (-) Ensembl panpan1.1 panPan2
JCAD Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 2 16,453,739 - 16,529,023 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 2 16,456,164 - 16,479,601 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 2 13,950,144 - 13,988,075 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 2 14,693,177 - 14,732,317 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 2 14,693,238 - 14,732,447 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 2 14,136,611 - 14,175,946 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 2 14,023,009 - 14,062,173 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 2 14,296,997 - 14,336,049 (-) NCBI UU_Cfam_GSD_1.0
Jcad Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024409344 9,481,075 - 9,532,660 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936613 4,047,265 - 4,083,272 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936613 4,047,310 - 4,083,235 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
JCAD Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 10 40,910,548 - 40,997,071 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 10 40,910,563 - 40,996,336 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 10 45,386,472 - 45,430,130 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
JCAD Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 9 29,615,543 - 29,725,240 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 9 29,620,631 - 29,655,511 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666051 35,706,748 - 35,804,880 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Jcad
.
Assembly: mRatBN7.2
Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Strain Variant Page
17
53097900
53097901
C
T
snv
BXH2/CubMcwi (2020) , HXB20/IpcvMcwi (2020), SHRSP/A3NCrl (2019), SHR/OlalpcvMcwi (2019), European Variation Archive Release 3, SHR/OlalpcvMcwi (2019NG), BXH2/CubMcwi (2023), European Variation Archive Release 6, SHRSP/A3NCrl (2019NG), SHR/NCrl (2021), SHR/NHsd (2021), European Variation Archive Release 4 View more Information
Assembly: Rnor_6.0
Predicted Target Of
Count of predictions: 111 Count of miRNA genes: 86 Interacting mature miRNAs: 93 Transcripts: ENSRNOT00000033359 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1354640 Scl32 Serum cholesterol level QTL 32 5.4 blood HDL cholesterol amount (VT:0000184) blood high density lipoprotein cholesterol level (CMO:0000052) 17 15781592 60781592 Rat 7411575 Bw140 Body weight QTL 140 30.2 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 17 48560935 86533673 Rat 2302377 Scl61 Serum cholesterol level QTL 61 4.36 blood HDL cholesterol amount (VT:0000184) serum high density lipoprotein cholesterol level (CMO:0000361) 17 27389946 53481766 Rat 1354654 Spl7 Serum phospholipid level QTL 7 5.5 blood phospholipid amount (VT:0006084) blood phospholipid level (CMO:0001169) 17 50890908 60781592 Rat 1354651 Lmblg2 Limb length QTL 2 6 tibia length (VT:0004357) tibia length (CMO:0000450) 17 4299130 69599340 Rat 1598871 Memor5 Memory QTL 5 5.3 exploratory behavior trait (VT:0010471) total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) 17 40540041 80387013 Rat 1354628 Stl13 Serum triglyceride level QTL 13 3.8 blood triglyceride amount (VT:0002644) blood triglyceride level (CMO:0000118) 17 21293039 60781592 Rat 1354629 Scl31 Serum cholesterol level QTL 31 4.1 blood cholesterol amount (VT:0000180) blood total cholesterol level (CMO:0000051) 17 50890908 60781592 Rat 1354630 Cm34 Cardiac mass QTL 34 8.7 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 17 4299130 69599340 Rat 1559055 Bp278 Blood pressure QTL 278 0.04 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 23653184 68653184 Rat 152025238 Slep14 Serum leptin concentration QTL 14 4.62 blood leptin amount (VT:0005667) 17 24184890 79524188 Rat 1354638 Insul1 Insulin level QTL 1 4.8 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 17 4299130 69599340 Rat 1354635 Bp245 Blood pressure QTL 245 6 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 42073160 69599340 Rat 1331765 Hrtrt15 Heart rate QTL 15 4.094 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 17 15330613 55836425 Rat 8694181 Bw151 Body weight QTL 151 4.36 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 17 48560935 86533673 Rat 1300148 Bp192 Blood pressure QTL 192 3.47 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 17 34550843 73951021 Rat 2317060 Aia26 Adjuvant induced arthritis QTL 26 3.22 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 17 38281509 83281509 Rat 4889955 Bss93 Bone structure and strength QTL 93 4.4 tibia size trait (VT:0100001) tibia cortical bone volume to tibia total bone volume ratio (CMO:0001727) 17 27027949 60463643 Rat 2324621 Coatc5 Coat color QTL 5 coat/hair pigmentation trait (VT:0010463) pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) 17 31368391 73951021 Rat 1354662 Rf49 Renal function QTL 49 2.9 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 17 1 69599340 Rat 152023740 Bp406 Blood pressure QTL 406 6.06 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat 1354663 Bvd5 Brain ventricular dilatation QTL 5 3.51 0.001 brain ventricle morphology trait (VT:0000822) hydrocephalus severity score (CMO:0001881) 17 31990784 81292925 Rat 7488966 Bp370 Blood pressure QTL 370 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 23653184 57246843 Rat 1354658 Spl8 Serum phospholipid level QTL 8 3.8 blood VLDL phospholipid amount (VT:0010507) blood very low density lipoprotein phospholipid level (CMO:0001571) 17 1 60781592 Rat 152023737 Bp405 Blood pressure QTL 405 5.06 arterial blood pressure trait (VT:2000000) 23930421 79524188 Rat 1354659 Scl68 Serum cholesterol level QTL 68 3.9 blood VLDL cholesterol amount (VT:0005144) blood very low density lipoprotein cholesterol level (CMO:0000648) 17 15781592 60781592 Rat 152023736 Bp404 Blood pressure QTL 404 3.78 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat 724528 Uae4 Urinary albumin excretion QTL 4 4.9 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 17 35837085 69599340 Rat 631497 Bp98 Blood pressure QTL 98 3.66 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 41354651 60463643 Rat 1354581 Bp247 Blood pressure QTL 247 4.5 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 17 1 69599340 Rat 1358295 Aocep1 Aortic cell protein QTL 1 6.1 7e-07 thoracic aorta cellular protein amount (VT:0010598) aortic cell percentage 17 40990005 85990005 Rat 152023626 Bp403 Blood pressure QTL 403 3.86 arterial blood pressure trait (VT:2000000) 17 23930421 79524188 Rat 2301412 Kidm40 Kidney mass QTL 40 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 17 37479847 82479847 Rat 9590107 Sffal7 Serum free fatty acids level QTL 7 4.81 0.001 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 17 28409147 73409147 Rat 2317038 Ginf3 Gastrointestinal inflammation QTL 3 2.89 0.005 liver integrity trait (VT:0010547) liver granuloma severity score (CMO:0002157) 17 49920154 86533673 Rat 724549 Niddm56 Non-insulin dependent diabetes mellitus QTL 56 0.03 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 17 31990784 76990784 Rat 1581512 Cm55 Cardiac mass QTL 55 2.8 0.05 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 17 27027949 56836890 Rat 61394 Bp8 Blood pressure QTL 8 2.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 23080567 59555013 Rat 10450503 Bp386 Blood pressure QTL 386 0.28 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 17 31368391 62109574 Rat 2317054 Aia12 Adjuvant induced arthritis QTL 12 4.24 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 17 38281509 83281509 Rat 2317053 Aia25 Adjuvant induced arthritis QTL 25 2.69 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 17 50909196 60781426 Rat 8552928 Pigfal9 Plasma insulin-like growth factor 1 level QTL 9 9 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 17 28409147 73409147 Rat 12903980 Cm120 Cardiac mass QTL 120 0.002 heart right ventricle mass (VT:0007033) heart right ventricle weight to body weight ratio (CMO:0000914) 17 23653184 68653184 Rat 12903981 Am17 Aortic mass QTL 17 0.001 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 17 23653184 68653184 Rat 2303561 Bw91 Body weight QTL 91 2 body mass (VT:0001259) body weight (CMO:0000012) 17 8868462 53868462 Rat 12903982 Kidm70 Kidney mass QTL 70 0.001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 17 23653184 70974005 Rat 4889894 Eae33 Experimental allergic encephalomyelitis QTL 33 5.2 0.0001 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis severity score (CMO:0001419) 17 50909099 86022412 Rat 12903978 Cm118 Cardiac mass QTL 118 0.001 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 17 23653184 68653184 Rat 12903979 Cm119 Cardiac mass QTL 119 0.001 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 17 23653184 68653184 Rat 1354619 Bp242 Blood pressure QTL 242 6.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 17 24599340 69599340 Rat 1354596 Bw32 Body weight QTL 32 4.5 body mass (VT:0001259) body weight (CMO:0000012) 17 4299130 60781592 Rat 2303580 Gluco49 Glucose level QTL 49 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 17 50040271 86533673 Rat
RH130648
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 17 53,089,462 - 53,089,642 (+) MAPPER mRatBN7.2 Rnor_6.0 17 55,667,835 - 55,668,014 NCBI Rnor6.0 Rnor_5.0 17 53,350,821 - 53,351,000 UniSTS Rnor5.0 RGSC_v3.4 17 61,350,471 - 61,350,650 UniSTS RGSC3.4 Celera 17 49,091,976 - 49,092,155 UniSTS RH 3.4 Map 17 556.1 UniSTS Cytogenetic Map 17 q12.1 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000033359 ⟹ ENSRNOP00000035031
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 17 53,089,382 - 53,130,967 (-) Ensembl Rnor_6.0 Ensembl 17 55,670,331 - 55,709,740 (-) Ensembl
RefSeq Acc Id:
NM_001427709 ⟹ NP_001414638
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,826,183 (-) NCBI
RefSeq Acc Id:
XM_008771786 ⟹ XP_008770008
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,811,879 (-) NCBI mRatBN7.2 17 53,091,854 - 53,116,627 (-) NCBI Rnor_6.0 17 55,671,208 - 55,694,950 (-) NCBI
Sequence:
ACACGTGAGCAACTCTGAAAAGCACAGCAGCAAGCCAAGAGGCCACCAGGAGTACCAAAGCTCTTCTTCTAGAACTCCCGAGGCGGGGTGTCTTGCAGAAACACACTGTCAAGGAAGGACTTCCAGAG
hide sequence
RefSeq Acc Id:
XM_008771788 ⟹ XP_008770010
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,811,875 (-) NCBI mRatBN7.2 17 53,091,854 - 53,116,629 (-) NCBI Rnor_6.0 17 55,671,208 - 55,694,944 (-) NCBI
Sequence:
GAGCAACTCTGAAAAGCACAGCAGCAAGCCAAGAGGCCACCAGGAGTACCAAAGCTCTTCTTCT
hide sequence
RefSeq Acc Id:
XM_008771790 ⟹ XP_008770012
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,811,882 (-) NCBI mRatBN7.2 17 53,091,854 - 53,116,630 (-) NCBI Rnor_6.0 17 55,671,208 - 55,694,945 (-) NCBI
Sequence:
TGAGCAACTCTGAAAAGCACAGCAGCAAGCCAAGAGGCCACCAGGAGTACCAAAGCTCTTCTTC
hide sequence
RefSeq Acc Id:
XM_039096446 ⟹ XP_038952374
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,826,213 (-) NCBI mRatBN7.2 17 53,091,854 - 53,130,985 (-) NCBI
RefSeq Acc Id:
XM_039096447 ⟹ XP_038952375
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,826,011 (-) NCBI mRatBN7.2 17 53,091,854 - 53,130,756 (-) NCBI
RefSeq Acc Id:
XM_039096448 ⟹ XP_038952376
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,825,485 (-) NCBI mRatBN7.2 17 53,091,854 - 53,130,490 (-) NCBI
RefSeq Acc Id:
XM_063276696 ⟹ XP_063132766
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 17 57,784,634 - 57,805,586 (-) NCBI
RefSeq Acc Id:
XP_008770008 ⟸ XM_008771786
- Peptide Label:
isoform X2
- Sequence:
MAQAHSLPIHVRESPWEVARRTEHVMKNALWEAELRMPTPAKWQDMTLESWKQPRKLGRQASDGDGQKRSQERFEDLYQFVHGEHMLTSQNRKKSQSLPRALSPKSLNFTEIPVPLHDGHITGVPKVP
hide sequence
RefSeq Acc Id:
XP_008770012 ⟸ XM_008771790
- Peptide Label:
isoform X2
- Sequence:
MAQAHSLPIHVRESPWEVARRTEHVMKNALWEAELRMPTPAKWQDMTLESWKQPRKLGRQASDG
hide sequence
RefSeq Acc Id:
XP_008770010 ⟸ XM_008771788
- Peptide Label:
isoform X2
- Sequence:
MAQAHSLPIHVRESPWEVARRTEHVMKNALWEAELRMPTPAKWQDMTLESWKQPRKLGRQASDGDGQKRSQERFEDLYQFVHGEHMLTSQNRKKSQSLPRALSPKSLNFTEIPVPLHDGHITGVPKVP
hide sequence
Ensembl Acc Id:
ENSRNOP00000035031 ⟸ ENSRNOT00000033359
RefSeq Acc Id:
XP_038952374 ⟸ XM_039096446
- Peptide Label:
isoform X1
- UniProtKB:
F1M6T3 (UniProtKB/TrEMBL), A6K9F8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038952375 ⟸ XM_039096447
- Peptide Label:
isoform X1
- UniProtKB:
F1M6T3 (UniProtKB/TrEMBL), A6K9F8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_038952376 ⟸ XM_039096448
- Peptide Label:
isoform X1
- UniProtKB:
F1M6T3 (UniProtKB/TrEMBL), A6K9F8 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001414638 ⟸ NM_001427709
- UniProtKB:
A6K9F8 (UniProtKB/TrEMBL), F1M6T3 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063132766 ⟸ XM_063276696
- Peptide Label:
isoform X2
RGD ID: 13700539 Promoter ID: EPDNEW_R11047 Type: initiation region Name: Jcad_1 Description: junctional cadherin 5 associated SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 17 55,709,728 - 55,709,788 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2017-05-12
Jcad
junctional cadherin 5 associated
RGD1562037
similar to OTTHUMP00000046255
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-04-30
RGD1562037
similar to OTTHUMP00000046255
RGD1562037_predicted
similar to OTTHUMP00000046255 (predicted)
'predicted' is removed
2292626 APPROVED
2006-03-07
RGD1562037_predicted
similar to OTTHUMP00000046255 (predicted)
LOC498764
similar to OTTHUMP00000046255
Symbol and Name status set to approved
1299863 APPROVED
2006-02-09
LOC498764
similar to OTTHUMP00000046255
Symbol and Name status set to provisional
70820 PROVISIONAL
