Symbol:
Gfra3
Name:
glial cell line derived neurotrophic factor family receptor alpha 3
RGD ID:
1552970
MGI Page
MGI
Description:
Enables axon guidance receptor activity. Acts upstream of or within axon guidance; neuron migration; and sympathetic nervous system development. Located in external side of plasma membrane. Is expressed in several structures, including adrenal medulla; alimentary system; cranial nerve; ganglia; and genitourinary system. Orthologous to human GFRA3 (GDNF family receptor alpha 3).
Type:
protein-coding
RefSeq Status:
REVIEWED
Previously known as:
GDNF family receptor alpha-3; GDNF receptor alpha-3; GDNFR-alpha-3; GFR alpha-3; GFR-alpha-3; GFRa; GFRalpha3; Y15110
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
GFRA3 (GDNF family receptor alpha 3) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Gfra3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Gfra3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
GFRA3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
GFRA3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Gfra3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
GFRA3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
GFRA3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Gfra3 (GDNF family receptor alpha 3) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Gfra3 (GDNF family receptor alpha 3)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
GFRA3 (GDNF family receptor alpha 3)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
gfra3 (GDNF family receptor alpha 3)
Alliance
DIOPT (Ensembl Compara|OMA|OrthoFinder|PANTHER|PhylomeDB|ZFIN)
Drosophila melanogaster (fruit fly):
Gfrl
Alliance
DIOPT (Ensembl Compara|PANTHER|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
gfra3
Alliance
DIOPT (OMA|OrthoFinder|PANTHER|PhylomeDB)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 34,822,951 - 34,853,440 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 34,822,951 - 34,853,440 (-) Ensembl GRCm39 Ensembl GRCm38 18 34,689,898 - 34,720,387 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 34,689,898 - 34,720,387 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 34,849,557 - 34,880,041 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 34,814,720 - 34,845,131 (-) NCBI MGSCv36 mm8 Celera 18 35,142,994 - 35,173,839 (-) NCBI Celera Cytogenetic Map 18 B1 NCBI cM Map 18 18.69 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Gfra3 Mouse 1,2-dichloroethane increases expression EXP 6480464 ethylene dichloride results in increased expression of GFRA3 mRNA CTD PMID:28960355 Gfra3 Mouse 1,2-dimethylhydrazine multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [APC protein affects the susceptibility to 1 and 2-Dimethylhydrazine] which results in increased expression of GFRA3 mRNA CTD PMID:27840820 Gfra3 Mouse 1,2-dimethylhydrazine decreases expression EXP 6480464 1 and 2-Dimethylhydrazine results in decreased expression of GFRA3 mRNA CTD PMID:22206623 Gfra3 Mouse 17beta-estradiol decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Estradiol results in decreased expression of GFRA3 mRNA CTD PMID:26945725 and PMID:32145629 Gfra3 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Gfra3 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin affects the expression of GFRA3 mRNA CTD PMID:22298810 Gfra3 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of GFRA3 mRNA CTD PMID:34747641 Gfra3 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of GFRA3 mRNA CTD PMID:21215274 Gfra3 Mouse 2,4-dinitrotoluene affects expression ISO Gfra3 (Rattus norvegicus) 6480464 2 and 4-dinitrotoluene affects the expression of GFRA3 mRNA CTD PMID:21346803 Gfra3 Mouse 2-methylcholine affects expression ISO GFRA3 (Homo sapiens) 6480464 beta-methylcholine affects the expression of GFRA3 mRNA CTD PMID:21179406 Gfra3 Mouse 6-propyl-2-thiouracil increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of GFRA3 mRNA CTD PMID:24780913 Gfra3 Mouse acetylsalicylic acid increases expression ISO GFRA3 (Homo sapiens) 6480464 Aspirin results in increased expression of GFRA3 mRNA CTD PMID:15928584 Gfra3 Mouse aflatoxin B1 increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Aflatoxin B1 results in increased expression of GFRA3 mRNA CTD PMID:23630614 Gfra3 Mouse aflatoxin B1 decreases methylation ISO GFRA3 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of GFRA3 intron CTD PMID:30157460 Gfra3 Mouse all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of GFRA3 mRNA CTD PMID:37278767 Gfra3 Mouse amitrole increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Amitrole results in increased expression of GFRA3 mRNA CTD PMID:30047161 Gfra3 Mouse ammonium chloride affects expression ISO Gfra3 (Rattus norvegicus) 6480464 Ammonium Chloride affects the expression of GFRA3 mRNA CTD PMID:16483693 Gfra3 Mouse amphetamine decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Amphetamine results in decreased expression of GFRA3 mRNA CTD PMID:30779732 Gfra3 Mouse amphotericin B increases expression ISO GFRA3 (Homo sapiens) 6480464 Amphotericin B analog results in increased expression of GFRA3 mRNA CTD PMID:28534445 Gfra3 Mouse aristolochic acid A increases expression ISO GFRA3 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of GFRA3 mRNA CTD PMID:33212167 Gfra3 Mouse benzo[a]pyrene multiple interactions EXP 6480464 AHR protein affects the reaction [Benzo(a)pyrene affects the expression of GFRA3 mRNA] CTD PMID:22228805 Gfra3 Mouse benzo[a]pyrene increases methylation ISO GFRA3 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of GFRA3 3' UTR and Benzo(a)pyrene results in increased methylation of GFRA3 exon CTD PMID:27901495 Gfra3 Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of GFRA3 mRNA CTD PMID:22228805 Gfra3 Mouse beta-lapachone increases expression ISO GFRA3 (Homo sapiens) 6480464 beta-lapachone results in increased expression of GFRA3 mRNA CTD PMID:38218311 Gfra3 Mouse beta-lapachone decreases expression ISO GFRA3 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of GFRA3 mRNA CTD PMID:38218311 Gfra3 Mouse bis(2-ethylhexyl) phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse bisphenol A increases expression ISO GFRA3 (Homo sapiens) 6480464 bisphenol A results in increased expression of GFRA3 mRNA CTD PMID:31715268 Gfra3 Mouse bisphenol A increases expression ISO Gfra3 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of GFRA3 mRNA CTD PMID:35192832 Gfra3 Mouse bisphenol A decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of GFRA3 mRNA CTD PMID:25181051 and PMID:32145629 Gfra3 Mouse bromuconazole increases expression ISO Gfra3 (Rattus norvegicus) 6480464 bromuconazole results in increased expression of GFRA3 mRNA CTD PMID:33789219 Gfra3 Mouse Butylbenzyl phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse carbamazepine affects expression EXP 6480464 Carbamazepine affects the expression of GFRA3 mRNA CTD PMID:22634333 Gfra3 Mouse chlorpyrifos decreases expression EXP 6480464 Chlorpyrifos results in decreased expression of GFRA3 mRNA CTD PMID:37019170 Gfra3 Mouse cisplatin decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Cisplatin results in decreased expression of GFRA3 mRNA CTD PMID:22023808 Gfra3 Mouse cyproconazole affects expression EXP 6480464 cyproconazole affects the expression of GFRA3 mRNA CTD PMID:22045034 Gfra3 Mouse dibutyl phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse diethyl phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse diisobutyl phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse diisononyl phthalate multiple interactions ISO Gfra3 (Rattus norvegicus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with Dibutyl Phthalate co-treated with diisononyl phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] results in decreased expression of GFRA3 mRNA CTD PMID:31199487 Gfra3 Mouse dorsomorphin multiple interactions ISO GFRA3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gfra3 Mouse endosulfan increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Endosulfan results in increased expression of GFRA3 mRNA CTD PMID:29391264 Gfra3 Mouse entinostat increases expression ISO GFRA3 (Homo sapiens) 6480464 entinostat results in increased expression of GFRA3 mRNA CTD PMID:27188386 Gfra3 Mouse flusilazole affects expression EXP 6480464 flusilazole affects the expression of GFRA3 mRNA CTD PMID:22634333 Gfra3 Mouse furan increases expression ISO Gfra3 (Rattus norvegicus) 6480464 furan results in increased expression of GFRA3 mRNA CTD PMID:25539665 Gfra3 Mouse gentamycin increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of GFRA3 mRNA CTD PMID:22061828 Gfra3 Mouse hydralazine multiple interactions ISO GFRA3 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of GFRA3 mRNA CTD PMID:17183730 Gfra3 Mouse indole-3-methanol affects expression ISO Gfra3 (Rattus norvegicus) 6480464 indole-3-carbinol affects the expression of GFRA3 mRNA CTD PMID:21396975 Gfra3 Mouse Licochalcone B increases expression ISO GFRA3 (Homo sapiens) 6480464 licochalcone B results in increased expression of GFRA3 mRNA CTD PMID:33647349 Gfra3 Mouse methimazole increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Methimazole results in increased expression of GFRA3 mRNA CTD PMID:30047161 Gfra3 Mouse N-methyl-4-phenylpyridinium increases expression ISO Gfra3 (Rattus norvegicus) 6480464 1-Methyl-4-phenylpyridinium results in increased expression of GFRA3 mRNA CTD PMID:28801915 Gfra3 Mouse naphthalene decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 naphthalene analog results in decreased expression of GFRA3 mRNA CTD PMID:24976557 Gfra3 Mouse nickel atom decreases expression ISO GFRA3 (Homo sapiens) 6480464 Nickel results in decreased expression of GFRA3 mRNA CTD PMID:24768652 and PMID:25583101 Gfra3 Mouse nitrofen decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 nitrofen results in decreased expression of GFRA3 mRNA CTD PMID:33484710 Gfra3 Mouse paracetamol affects expression EXP 6480464 Acetaminophen affects the expression of GFRA3 mRNA CTD PMID:17562736 Gfra3 Mouse paraquat decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Paraquat results in decreased expression of GFRA3 mRNA CTD PMID:32680482 Gfra3 Mouse perfluorohexanesulfonic acid decreases expression EXP 6480464 perfluorohexanesulfonic acid results in decreased expression of GFRA3 mRNA CTD PMID:37995155 Gfra3 Mouse rotenone increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Rotenone results in increased expression of GFRA3 mRNA CTD PMID:28374803 Gfra3 Mouse SB 431542 multiple interactions ISO GFRA3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Gfra3 Mouse sodium arsenite increases expression ISO GFRA3 (Homo sapiens) 6480464 sodium arsenite results in increased expression of GFRA3 mRNA CTD PMID:38568856 Gfra3 Mouse sodium arsenite increases expression EXP 6480464 sodium arsenite results in increased expression of GFRA3 mRNA CTD PMID:37682722 Gfra3 Mouse sulfadimethoxine increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Sulfadimethoxine results in increased expression of GFRA3 mRNA CTD PMID:30047161 Gfra3 Mouse tetrachloromethane decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in decreased expression of GFRA3 mRNA CTD PMID:31150632 Gfra3 Mouse thioacetamide decreases expression ISO Gfra3 (Rattus norvegicus) 6480464 Thioacetamide results in decreased expression of GFRA3 mRNA CTD PMID:34492290 Gfra3 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of GFRA3 gene CTD PMID:35295148 Gfra3 Mouse Tributyltin oxide increases expression EXP 6480464 bis(tri-n-butyltin)oxide results in increased expression of GFRA3 mRNA CTD PMID:18958704 Gfra3 Mouse trichloroethene increases methylation ISO Gfra3 (Rattus norvegicus) 6480464 Trichloroethylene results in increased methylation of GFRA3 gene CTD PMID:27618143 Gfra3 Mouse trichloroethene increases expression ISO Gfra3 (Rattus norvegicus) 6480464 Trichloroethylene results in increased expression of GFRA3 mRNA CTD PMID:33387578 Gfra3 Mouse trichostatin A increases expression ISO GFRA3 (Homo sapiens) 6480464 trichostatin A results in increased expression of GFRA3 mRNA CTD PMID:24935251 and PMID:26272509 Gfra3 Mouse trichostatin A multiple interactions ISO GFRA3 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of GFRA3 mRNA CTD PMID:27188386 Gfra3 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of GFRA3 mRNA CTD PMID:33045310 Gfra3 Mouse valproic acid increases methylation ISO GFRA3 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of GFRA3 gene CTD PMID:29154799 Gfra3 Mouse valproic acid multiple interactions ISO GFRA3 (Homo sapiens) 6480464 [Hydralazine co-treated with Valproic Acid] results in increased expression of GFRA3 mRNA more ... CTD PMID:17183730 and PMID:27188386 Gfra3 Mouse valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of GFRA3 mRNA CTD PMID:17963808 and PMID:22045034 Gfra3 Mouse valproic acid increases expression ISO GFRA3 (Homo sapiens) 6480464 Valproic Acid results in increased expression of GFRA3 mRNA CTD PMID:26272509 and PMID:29154799 Gfra3 Mouse XL147 multiple interactions EXP 6480464 [N-nitroso-tris-chloroethylurea co-treated with XL147] results in decreased expression of GFRA3 mRNA CTD PMID:27935865
1,2-dichloroethane (EXP) 1,2-dimethylhydrazine (EXP,ISO) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-dinitrotoluene (ISO) 2-methylcholine (ISO) 6-propyl-2-thiouracil (ISO) acetylsalicylic acid (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (EXP) amitrole (ISO) ammonium chloride (ISO) amphetamine (ISO) amphotericin B (ISO) aristolochic acid A (ISO) benzo[a]pyrene (EXP,ISO) beta-lapachone (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (ISO) bromuconazole (ISO) Butylbenzyl phthalate (ISO) carbamazepine (EXP) chlorpyrifos (EXP) cisplatin (ISO) cyproconazole (EXP) dibutyl phthalate (ISO) diethyl phthalate (ISO) diisobutyl phthalate (ISO) diisononyl phthalate (ISO) dorsomorphin (ISO) endosulfan (ISO) entinostat (ISO) flusilazole (EXP) furan (ISO) gentamycin (ISO) hydralazine (ISO) indole-3-methanol (ISO) Licochalcone B (ISO) methimazole (ISO) N-methyl-4-phenylpyridinium (ISO) naphthalene (ISO) nickel atom (ISO) nitrofen (ISO) paracetamol (EXP) paraquat (ISO) perfluorohexanesulfonic acid (EXP) rotenone (ISO) SB 431542 (ISO) sodium arsenite (EXP,ISO) sulfadimethoxine (ISO) tetrachloromethane (ISO) thioacetamide (ISO) titanium dioxide (EXP) Tributyltin oxide (EXP) trichloroethene (ISO) trichostatin A (ISO) triptonide (EXP) valproic acid (EXP,ISO) XL147 (EXP)
Gfra3 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 18 34,822,951 - 34,853,440 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 18 34,822,951 - 34,853,440 (-) Ensembl GRCm39 Ensembl GRCm38 18 34,689,898 - 34,720,387 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 18 34,689,898 - 34,720,387 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 18 34,849,557 - 34,880,041 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 18 34,814,720 - 34,845,131 (-) NCBI MGSCv36 mm8 Celera 18 35,142,994 - 35,173,839 (-) NCBI Celera Cytogenetic Map 18 B1 NCBI cM Map 18 18.69 NCBI
GFRA3 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 138,252,380 - 138,274,621 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 138,252,380 - 138,274,621 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 137,588,069 - 137,610,310 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 137,615,968 - 137,638,152 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 137,615,969 - 137,638,152 NCBI Celera 5 133,709,300 - 133,731,054 (-) NCBI Celera Cytogenetic Map 5 q31.2 NCBI HuRef 5 132,779,039 - 132,801,225 (-) NCBI HuRef CHM1_1 5 137,020,644 - 137,042,862 (-) NCBI CHM1_1 T2T-CHM13v2.0 5 138,778,613 - 138,800,853 (-) NCBI T2T-CHM13v2.0
Gfra3 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 18 26,571,952 - 26,600,225 (-) NCBI GRCr8 mRatBN7.2 18 26,297,828 - 26,326,105 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 18 26,297,829 - 26,326,105 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 18 26,425,209 - 26,453,481 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 18 27,189,072 - 27,217,348 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 18 26,523,972 - 26,552,248 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 18 27,491,860 - 27,520,133 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 18 27,491,845 - 27,520,295 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 18 27,205,217 - 27,233,490 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 18 27,167,576 - 27,195,848 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 18 27,195,323 - 27,208,736 (-) NCBI Celera 18 26,035,434 - 26,063,700 (-) NCBI Celera Cytogenetic Map 18 p12 NCBI
Gfra3 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955418 2,143,169 - 2,163,286 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955418 2,152,887 - 2,162,883 (+) NCBI ChiLan1.0 ChiLan1.0
GFRA3 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 133,524,342 - 133,547,975 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 5 131,663,952 - 131,687,529 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 5 133,630,274 - 133,652,525 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 5 139,762,690 - 139,784,942 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 5 139,762,690 - 139,784,942 (-) Ensembl panpan1.1 panPan2
GFRA3 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 11 25,881,523 - 25,897,863 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 11 25,882,099 - 25,897,817 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 11 24,652,055 - 24,667,781 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 11 26,738,265 - 26,754,257 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 11 26,690,528 - 26,754,264 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 11 25,445,543 - 25,461,486 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 11 25,268,312 - 25,284,034 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 11 25,932,678 - 25,948,643 (-) NCBI UU_Cfam_GSD_1.0
Gfra3 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 154,146,854 - 154,167,704 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936531 7,444,147 - 7,464,523 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936531 7,443,842 - 7,457,518 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
GFRA3 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 140,263,301 - 140,283,066 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 140,263,297 - 140,283,227 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 145,962,140 - 145,982,527 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
GFRA3 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 23 40,927,283 - 40,948,591 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 23 40,927,289 - 40,946,023 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666034 36,940,183 - 36,964,179 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Gfra3
.
Predicted Target Of
Count of predictions: 233 Count of miRNA genes: 196 Interacting mature miRNAs: 207 Transcripts: ENSMUST00000025224 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1558743 Kcal1_m kilocalorie 1 (mouse) Not determined 18 19018874 53018992 Mouse 1302163 Bmd16_m bone mineral density 16 (mouse) Not determined 18 29667914 63668060 Mouse 11532716 Sluc41c_m susceptibility to lung cancer 41c (mouse) 18 22619914 56620127 Mouse 11532715 Sluc41b_m susceptibility to lung cancer 41b (mouse) 18 22619914 56620127 Mouse 11532710 Sluc41a_m susceptibility to lung cancer 41a (mouse) 18 22619914 56620127 Mouse 25823171 Hrsq10_m host response to SARS QTL 10, D4% weight (mouse) 18 27241115 58827077 Mouse 11532709 Sluc41_m susceptibility to lung cancer 41 (mouse) 18 20953694 57590708 Mouse 1301400 Lmr13_m leishmaniasis resistance 13 (mouse) Not determined 18 28109380 62109518 Mouse 25823174 Hrsq11_m host response to SARS QTL 11, log titer (mouse) 18 27241115 58827077 Mouse 1300638 Im7_m immunoregulatory 7 (mouse) Not determined 18 19018874 53018992 Mouse 1558873 Hrtfm7_m heart failure modifier 7 (mouse) Not determined 18 8086964 42087106 Mouse 25823173 Hrsq12_m host response to SARS QTL 12, hemorrhage (mouse) 18 24895881 78339555 Mouse 1300994 Pvcan3_m protection against vaginal candidiasis 3 (mouse) Not determined 18 16199640 50199776 Mouse 1301570 Sluc14_m susceptibility to lung cancer 14 (mouse) Not determined 18 22619914 56620127 Mouse 13504732 Cath6_m carotid atherosclerosis 6 (mouse) 18 13637126 47637126 Mouse 1558849 W3q15_m weight 3 weeks QTL 15 (mouse) Not determined 18 5041119 61272643 Mouse 12880412 V125Dq12_m vitamin D active form serum level QTL 12 (mouse) 18 30233067 64233067 Mouse 1300877 Adip8_m adiposity 8 (mouse) Not determined 18 22619914 56620127 Mouse 4141857 Mhysq5_m male hybrid sterility QTL 5 (mouse) Not determined 28130604 62130739 Mouse 1300685 Scc5_m colon tumor susceptibility 5 (mouse) Not determined 18 31988480 65988629 Mouse 1301307 Phospq1_m phospholipid QTL 1 (mouse) Not determined 18 18139704 52139859 Mouse 1301950 Otx2m1_m orthodenticle homolog 2 (Drosophila) modifier 1 (mouse) Not determined 18 21568682 36187740 Mouse 1357690 Vtbt19_m vertebral trabecular bone trait 19 (mouse) Not determined 18 33091043 67091221 Mouse 4142031 Moen1_m modifier of engrailed QTL 1 (mouse) Not determined 18 24115560 58115730 Mouse 12904950 Smmq3_m soleus muscle mass QTL 3 (mouse) 18 26056875 60056875 Mouse 25823167 Hrsq5_m host response to SARS QTL 5, D3% weight (mouse) 18 27241115 58827077 Mouse 1357603 Mom3_m modifier of Min 3 (mouse) Not determined 18 14030023 67098962 Mouse 13463476 Hctq8_m hematocrit QTL 8 (mouse) 18 21217580 55217727 Mouse 27226723 Tibw9_m tibia width 9, proximal, 16 week (mouse) 18 3200000 60933072 Mouse
Y15110
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 18 34,690,051 - 34,690,188 UniSTS GRCm38 MGSCv37 18 34,849,705 - 34,849,842 UniSTS GRCm37 Celera 18 35,143,142 - 35,143,279 UniSTS Cytogenetic Map 18 B1 UniSTS
Gfra3
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 18 B1 UniSTS cM Map 18 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000025224 ⟹ ENSMUSP00000025224
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 18 34,822,951 - 34,853,440 (-) Ensembl GRCm38.p6 Ensembl 18 34,689,898 - 34,720,387 (-) Ensembl
RefSeq Acc Id:
NM_010280 ⟹ NP_034410
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 18 34,822,951 - 34,853,440 (-) NCBI GRCm38 18 34,689,898 - 34,720,387 (-) NCBI MGSCv37 18 34,849,557 - 34,880,041 (-) RGD Celera 18 35,142,994 - 35,173,839 (-) RGD cM Map 18 ENTREZGENE
Sequence:
GCCCACGACCCTAGTGGGAGAGTGGCGGCGCCGCGAGGAGGGGCGGGAGGCGGCGGTGGGAGGTGTCGGCCGAGGGAGCCCAGCTCTCCGAGTCCTGTGCACCAAGGCAGGGGAACGCGGCGCCCAGC
hide sequence
RefSeq Acc Id:
NP_034410 ⟸ NM_010280
- Peptide Label:
preproprotein
- UniProtKB:
Q6NZC2 (UniProtKB/Swiss-Prot), O55243 (UniProtKB/Swiss-Prot), O35325 (UniProtKB/Swiss-Prot), Q8C8L9 (UniProtKB/Swiss-Prot), O35118 (UniProtKB/Swiss-Prot), Q9R2D0 (UniProtKB/TrEMBL)
- Sequence:
MGLSWSPRPPLLMILLLVLSLWLPLGAGNSLATENRFVNSCTQARKKCEANPACKAAYQHLGSCTSSLSRPLPLEESAMSADCLEAAEQLRNSSLIDCRCHRRMKHQATCLDIYWTVHPARSLGDYEL
hide sequence
Ensembl Acc Id:
ENSMUSP00000025224 ⟸ ENSMUST00000025224
RGD ID: 13677382 Promoter ID: EPDNEW_M22840 Type: initiation region Name: Gfra3_1 Description: Mus musculus glial cell line derived neurotrophic factor familyreceptor alpha 3 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 18 34,720,291 - 34,720,351 EPDNEW
