Symbol:
Aggf1
Name:
angiogenic factor with G patch and FHA domains 1
RGD ID:
1551247
MGI Page
MGI
Description:
Predicted to enable identical protein binding activity and nucleic acid binding activity. Predicted to be involved in cell adhesion; positive regulation of angiogenesis; and positive regulation of endothelial cell proliferation. Predicted to be located in extracellular region and perinuclear region of cytoplasm. Is expressed in several structures, including central nervous system; egg cylinder; genitourinary system; primitive streak; and sensory organ. Orthologous to human AGGF1 (angiogenic factor with G-patch and FHA domains 1).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
2010009L17Rik; 2310029P06Rik; angiogenic factor VG5Q; AW112072; mVG5Q; Peg3; VG5; VG5Q
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
AGGF1 (angiogenic factor with G-patch and FHA domains 1) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Aggf1 (angiogenic factor with G patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Aggf1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
AGGF1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
AGGF1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Aggf1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
AGGF1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
AGGF1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Aggf1 (angiogenic factor with G-patch and FHA domains 1) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Aggf1 (angiogenic factor with G patch and FHA domains 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
AGGF1 (angiogenic factor with G-patch and FHA domains 1)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
aggf1 (angiogenic factor with G patch and FHA domains 1)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Drosophila melanogaster (fruit fly):
CG8079
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
Y55D9A.2
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
aggf1
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 95,487,191 - 95,511,865 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 95,487,191 - 95,511,860 (-) Ensembl GRCm39 Ensembl GRCm38 13 95,350,683 - 95,375,357 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 95,350,683 - 95,375,352 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 96,120,671 - 96,145,289 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 96,451,415 - 96,476,033 (-) NCBI MGSCv36 mm8 Celera 13 98,972,068 - 98,996,687 (-) NCBI Celera Cytogenetic Map 13 D1 NCBI cM Map 13 49.41 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Aggf1 Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of AGGF1 mRNA CTD PMID:36331819 Aggf1 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of AGGF1 mRNA CTD PMID:22206623 Aggf1 Mouse 2,2',5,5'-tetrachlorobiphenyl decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 2 more ... CTD PMID:23829299 Aggf1 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of AGGF1 mRNA CTD PMID:21570461 Aggf1 Mouse 2,4-dinitrotoluene affects expression ISO Aggf1 (Rattus norvegicus) 6480464 2 and 4-dinitrotoluene affects the expression of AGGF1 mRNA CTD PMID:21346803 Aggf1 Mouse 2,6-dinitrotoluene affects expression ISO Aggf1 (Rattus norvegicus) 6480464 2 and 6-dinitrotoluene affects the expression of AGGF1 mRNA CTD PMID:21346803 Aggf1 Mouse 2-hydroxypropanoic acid decreases expression ISO AGGF1 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of AGGF1 mRNA CTD PMID:30851411 Aggf1 Mouse 2-palmitoylglycerol increases expression ISO AGGF1 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of AGGF1 mRNA CTD PMID:37199045 Aggf1 Mouse 3,4-methylenedioxymethamphetamine increases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in increased expression of AGGF1 mRNA CTD PMID:20188158 Aggf1 Mouse 4,4'-diaminodiphenylmethane affects expression EXP 6480464 4 and 4'-diaminodiphenylmethane affects the expression of AGGF1 mRNA CTD PMID:18648102 Aggf1 Mouse 5-azacytidine increases expression ISO AGGF1 (Homo sapiens) 6480464 Azacitidine results in increased expression of AGGF1 mRNA CTD PMID:19194470 Aggf1 Mouse acrylamide decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 Acrylamide results in decreased expression of AGGF1 mRNA CTD PMID:28959563 Aggf1 Mouse aflatoxin B1 decreases methylation ISO AGGF1 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of AGGF1 gene CTD PMID:27153756 Aggf1 Mouse arsane affects methylation ISO AGGF1 (Homo sapiens) 6480464 Arsenic affects the methylation of AGGF1 gene CTD PMID:25304211 Aggf1 Mouse arsenic atom affects methylation ISO AGGF1 (Homo sapiens) 6480464 Arsenic affects the methylation of AGGF1 gene CTD PMID:25304211 Aggf1 Mouse atrazine decreases expression ISO AGGF1 (Homo sapiens) 6480464 Atrazine results in decreased expression of AGGF1 mRNA CTD PMID:22378314 Aggf1 Mouse benzo[a]pyrene decreases expression ISO AGGF1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of AGGF1 mRNA CTD PMID:22316170 Aggf1 Mouse benzo[a]pyrene decreases expression EXP 6480464 Benzo(a)pyrene results in decreased expression of AGGF1 mRNA CTD PMID:20127859 and PMID:22228805 Aggf1 Mouse bisphenol A decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of AGGF1 mRNA CTD PMID:25181051 Aggf1 Mouse cadmium dichloride decreases expression ISO AGGF1 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of AGGF1 mRNA CTD PMID:38568856 Aggf1 Mouse caffeine increases phosphorylation ISO AGGF1 (Homo sapiens) 6480464 Caffeine results in increased phosphorylation of AGGF1 protein CTD PMID:35688186 Aggf1 Mouse carbamazepine affects expression ISO AGGF1 (Homo sapiens) 6480464 Carbamazepine affects the expression of AGGF1 mRNA CTD PMID:24752500 Aggf1 Mouse chlorpyrifos decreases expression EXP 6480464 Chlorpyrifos results in decreased expression of AGGF1 mRNA CTD PMID:37019170 Aggf1 Mouse copper(II) sulfate decreases expression ISO AGGF1 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of AGGF1 mRNA CTD PMID:19549813 Aggf1 Mouse Cuprizon decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 Cuprizone results in decreased expression of AGGF1 mRNA CTD PMID:26577399 Aggf1 Mouse cyclosporin A decreases expression ISO AGGF1 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of AGGF1 mRNA CTD PMID:25562108 Aggf1 Mouse Dibutyl phosphate affects expression ISO AGGF1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of AGGF1 mRNA CTD PMID:37042841 Aggf1 Mouse diclofenac affects expression ISO AGGF1 (Homo sapiens) 6480464 Diclofenac affects the expression of AGGF1 mRNA CTD PMID:24752500 Aggf1 Mouse dicrotophos decreases expression ISO AGGF1 (Homo sapiens) 6480464 dicrotophos results in decreased expression of AGGF1 mRNA CTD PMID:28302478 Aggf1 Mouse endosulfan decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 Endosulfan results in decreased expression of AGGF1 mRNA CTD PMID:29391264 Aggf1 Mouse ethanol affects splicing EXP 6480464 Ethanol affects the splicing of AGGF1 mRNA CTD PMID:30319688 Aggf1 Mouse folic acid multiple interactions EXP 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in increased expression of AGGF1 mRNA CTD PMID:22206623 Aggf1 Mouse FR900359 increases phosphorylation ISO AGGF1 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of AGGF1 protein CTD PMID:37730182 Aggf1 Mouse gentamycin decreases expression ISO Aggf1 (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of AGGF1 mRNA CTD PMID:33387578 Aggf1 Mouse GSK-J4 decreases expression ISO AGGF1 (Homo sapiens) 6480464 GSK-J4 results in decreased expression of AGGF1 mRNA CTD PMID:29301935 Aggf1 Mouse hydroquinone decreases expression ISO AGGF1 (Homo sapiens) 6480464 hydroquinone results in decreased expression of AGGF1 mRNA CTD PMID:31256213 Aggf1 Mouse methoxychlor affects methylation ISO Aggf1 (Rattus norvegicus) 6480464 Methoxychlor affects the methylation of AGGF1 gene CTD PMID:35440735 Aggf1 Mouse N,N-diethyl-m-toluamide multiple interactions ISO Aggf1 (Rattus norvegicus) 6480464 [Permethrin co-treated with DEET] results in decreased methylation of AGGF1 gene CTD PMID:33148267 Aggf1 Mouse nitrates multiple interactions EXP 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of AGGF1 mRNA CTD PMID:35964746 Aggf1 Mouse ochratoxin A decreases expression ISO AGGF1 (Homo sapiens) 6480464 ochratoxin A results in decreased expression of AGGF1 mRNA CTD PMID:30559759 Aggf1 Mouse paracetamol decreases expression ISO AGGF1 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of AGGF1 mRNA CTD PMID:21420995 Aggf1 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of AGGF1 mRNA and [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of AGGF1 mRNA CTD PMID:36331819 Aggf1 Mouse permethrin multiple interactions ISO Aggf1 (Rattus norvegicus) 6480464 [Permethrin co-treated with DEET] results in decreased methylation of AGGF1 gene CTD PMID:33148267 Aggf1 Mouse pirinixic acid multiple interactions EXP 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in decreased expression of AGGF1 mRNA CTD PMID:19710929 Aggf1 Mouse rac-lactic acid decreases expression ISO AGGF1 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of AGGF1 mRNA CTD PMID:30851411 Aggf1 Mouse resveratrol multiple interactions ISO AGGF1 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of AGGF1 mRNA CTD PMID:23557933 Aggf1 Mouse silver atom decreases expression ISO AGGF1 (Homo sapiens) 6480464 Silver results in decreased expression of AGGF1 mRNA CTD PMID:26014281 Aggf1 Mouse silver(0) decreases expression ISO AGGF1 (Homo sapiens) 6480464 Silver results in decreased expression of AGGF1 mRNA CTD PMID:26014281 Aggf1 Mouse testosterone enanthate affects expression ISO AGGF1 (Homo sapiens) 6480464 testosterone enanthate affects the expression of AGGF1 mRNA CTD PMID:17440010 Aggf1 Mouse thiram decreases expression ISO AGGF1 (Homo sapiens) 6480464 Thiram results in decreased expression of AGGF1 mRNA CTD PMID:38568856 Aggf1 Mouse titanium dioxide decreases methylation EXP 6480464 titanium dioxide results in decreased methylation of AGGF1 gene CTD PMID:35295148 Aggf1 Mouse triphenyl phosphate affects expression ISO AGGF1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of AGGF1 mRNA CTD PMID:37042841 Aggf1 Mouse valproic acid affects expression ISO AGGF1 (Homo sapiens) 6480464 Valproic Acid affects the expression of AGGF1 mRNA CTD PMID:25979313 Aggf1 Mouse valproic acid decreases methylation ISO AGGF1 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of AGGF1 gene CTD PMID:29154799 Aggf1 Mouse vinclozolin increases methylation ISO Aggf1 (Rattus norvegicus) 6480464 vinclozolin results in increased methylation of AGGF1 gene CTD PMID:31682807 Aggf1 Mouse vorinostat decreases expression ISO AGGF1 (Homo sapiens) 6480464 vorinostat results in decreased expression of AGGF1 mRNA CTD PMID:27188386
(1->4)-beta-D-glucan (EXP) 1,2-dimethylhydrazine (EXP) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP) 2,4-dinitrotoluene (ISO) 2,6-dinitrotoluene (ISO) 2-hydroxypropanoic acid (ISO) 2-palmitoylglycerol (ISO) 3,4-methylenedioxymethamphetamine (EXP) 4,4'-diaminodiphenylmethane (EXP) 5-azacytidine (ISO) acrylamide (ISO) aflatoxin B1 (ISO) arsane (ISO) arsenic atom (ISO) atrazine (ISO) benzo[a]pyrene (EXP,ISO) bisphenol A (ISO) cadmium dichloride (ISO) caffeine (ISO) carbamazepine (ISO) chlorpyrifos (EXP) copper(II) sulfate (ISO) Cuprizon (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) diclofenac (ISO) dicrotophos (ISO) endosulfan (ISO) ethanol (EXP) folic acid (EXP) FR900359 (ISO) gentamycin (ISO) GSK-J4 (ISO) hydroquinone (ISO) methoxychlor (ISO) N,N-diethyl-m-toluamide (ISO) nitrates (EXP) ochratoxin A (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (EXP) permethrin (ISO) pirinixic acid (EXP) rac-lactic acid (ISO) resveratrol (ISO) silver atom (ISO) silver(0) (ISO) testosterone enanthate (ISO) thiram (ISO) titanium dioxide (EXP) triphenyl phosphate (ISO) valproic acid (ISO) vinclozolin (ISO) vorinostat (ISO)
1.
Mouse brain organization revealed through direct genome-scale TF expression analysis.
Gray PA, etal., Science 2004 Dec 24;306(5705):2255-7.
2.
Functional annotation of a full-length mouse cDNA collection.
Kawai J, etal., Nature. 2001 Feb 8;409(6821):685-90.
3.
MGDs mouse GO annotations
MGD data from the GO Consortium
4.
Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs.
Okazaki Y, etal., Nature. 2002 Dec 5;420(6915):563-73.
5.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
6.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
7.
Database resources of the National Center for Biotechnology Information.
Wheeler DL, etal., Nucleic Acids Res 2001 Jan 1;29(1):11-6.
Aggf1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 95,487,191 - 95,511,865 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 95,487,191 - 95,511,860 (-) Ensembl GRCm39 Ensembl GRCm38 13 95,350,683 - 95,375,357 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 95,350,683 - 95,375,352 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 96,120,671 - 96,145,289 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 96,451,415 - 96,476,033 (-) NCBI MGSCv36 mm8 Celera 13 98,972,068 - 98,996,687 (-) NCBI Celera Cytogenetic Map 13 D1 NCBI cM Map 13 49.41 NCBI
AGGF1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 5 77,030,404 - 77,065,234 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 5 77,029,251 - 77,065,234 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 5 76,326,229 - 76,361,059 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 5 76,361,988 - 76,396,794 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 5 76,361,987 - 76,396,791 NCBI Celera 5 72,220,718 - 72,255,361 (+) NCBI Celera Cytogenetic Map 5 q13.3 NCBI HuRef 5 71,532,859 - 71,567,837 (+) NCBI HuRef CHM1_1 5 75,759,108 - 75,794,521 (+) NCBI CHM1_1 T2T-CHM13v2.0 5 77,512,128 - 77,546,904 (+) NCBI T2T-CHM13v2.0
Aggf1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 28,354,073 - 28,380,794 (-) NCBI GRCr8 mRatBN7.2 2 26,619,336 - 26,646,050 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 26,619,339 - 26,645,952 (-) Ensembl mRatBN7.2 Ensembl Rnor_6.0 2 25,068,804 - 25,095,429 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 25,069,620 - 25,095,106 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 44,227,286 - 44,253,899 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 25,723,668 - 25,749,359 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 25,644,037 - 25,679,865 (-) NCBI Celera 2 22,684,509 - 22,711,225 (-) NCBI Celera Cytogenetic Map 2 q12 NCBI
Aggf1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955425 23,847,673 - 23,874,404 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955425 23,847,502 - 23,873,964 (-) NCBI ChiLan1.0 ChiLan1.0
AGGF1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 4 38,232,858 - 38,265,220 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 5 36,386,503 - 36,418,418 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 5 38,236,209 - 38,268,530 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 5 38,762,317 - 38,794,606 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 5 38,762,317 - 38,794,594 (-) Ensembl panpan1.1 panPan2
AGGF1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 3 29,578,050 - 29,682,265 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 3 29,647,592 - 29,682,776 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 3 30,804,004 - 30,921,635 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 3 29,486,014 - 29,601,272 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 3 29,566,220 - 29,601,792 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 3 29,420,293 - 29,538,033 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 3 29,400,940 - 29,518,896 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 3 29,770,262 - 29,888,021 (-) NCBI UU_Cfam_GSD_1.0
Aggf1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024407213 185,749,025 - 185,789,458 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936549 5,068,656 - 5,111,406 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936549 5,069,164 - 5,109,299 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
AGGF1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 2 85,890,481 - 85,934,358 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 2 85,890,423 - 85,941,314 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 2 87,506,911 - 87,552,643 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
AGGF1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 4 71,277,293 - 71,309,973 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 4 71,277,315 - 71,310,159 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666049 20,115,923 - 20,148,633 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Aggf1
.
Predicted Target Of
Count of predictions: 320 Count of miRNA genes: 262 Interacting mature miRNAs: 288 Transcripts: ENSMUST00000022189, ENSMUST00000161671 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1558741 Ses10_m salmonella enteritidis susceptibility 10 (mouse) Not determined 13 82739968 116740106 Mouse 12879495 Fexq1_m fear expression QTL 1 (mouse) 13 78268858 95836553 Mouse 10043997 Bw40_m body weight QTL 40 (mouse) Not determined 14 79239045 113239162 Mouse 1301142 Heal2_m wound healing/regeneration 2 (mouse) Not determined 13 93875267 120883175 Mouse 1357468 Rplag_m reduced platelet aggregation (mouse) Not determined 13 95502130 120883175 Mouse 1301593 Heal8_m wound healing/regeneration 8 (mouse) Not determined 13 68053999 102054119 Mouse 10412235 Scgq5_m spontaneous crescentic glomerulonephritis QTL 5 (mouse) Not determined 13 36060908 96239162 Mouse 4142314 Tailaq3_m tail length adjusted QTL 3 (mouse) Not determined 55720354 112431103 Mouse 1301445 Listr2_m listeriosis resistance 2 (mouse) Not determined 13 66744601 100744746 Mouse 12880402 Emlq1_m emotional learning QTL 1 (mouse) 13 78108858 96866553 Mouse 4141992 W6q16_m weight 6 weeks QTL 16 (mouse) Not determined 55720354 112431103 Mouse 1300939 Hrtfm6_m heart failure modifier 6 (mouse) Not determined 13 91383692 120883175 Mouse 12880414 V125Dq10_m vitamin D active form serum level QTL 10 (mouse) 13 78036508 112036508 Mouse 4142241 Tailq3_m tail length QTL 3 (mouse) Not determined 55720354 112431103 Mouse 1300941 Skl6_m skeletal size (tail length) 6 (mouse) Not determined 13 64250821 98250945 Mouse 14747007 Mancz11_m mandible centroid size 11 (mouse) 13 70111284 104111284 Mouse 4141728 Egaq4_m early growth adjusted QTL 4 (mouse) Not determined 87901985 112431103 Mouse 1300876 Tanidd2_m tally ho associated non-insulin dependednt diabetes mellitus 2 (mouse) Not determined 13 91965303 120883175 Mouse 4140959 W10q17_m weight 10 weeks QTL 17 (mouse) Not determined 55720354 112431103 Mouse 1357553 Cia28_m collagen induced arthritis 28 (mouse) Not determined 13 56629249 96239162 Mouse 4141266 Mol3_m modifier of LPS-response 3 (mouse) Not determined 76132600 112431103 Mouse 1301949 Skull20_m skull morphology 20 (mouse) Not determined 13 64250821 98250945 Mouse 10045623 Heal18_m wound healing regeneration 18 (mouse) Not determined 13 79239045 113239162 Mouse 10402414 Sgp5_m serum gp70 production 5 (mouse) Not determined 13 56470456 105422186 Mouse 14700691 Cisaq1_m coxsackieviral infection serum ALT QTL 1 (mouse) 13 86148119 120461536 Mouse 14696726 Kidrq3_m kidney weight, right QTL 3 (mouse) 13 68217066 102217066 Mouse 1301610 Dps1_m delta power in slow-wave sleep 1 (mouse) Not determined 13 77195862 95730894 Mouse 4142147 Mvwf4_m modifier of von Willebrand factor 4 (mouse) Not determined 20477612 112898424 Mouse 4140995 Fbtq6_m femoral bone trait QTL 6 (mouse) Not determined 13 86341617 120341758 Mouse 1558763 Gct9_m granulosa cell tumorigenesis 9 (mouse) Not determined 13 95036824 120883175 Mouse 4142338 Skmw18_m skeletal muscle weight 18 (mouse) Not determined 13 94528399 120883175 Mouse 4142465 Pbwg17_m postnatal body weight growth 17 (mouse) Not determined 13 83876060 117876256 Mouse
AW112072
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 13 95,350,784 - 95,350,886 UniSTS GRCm38 MGSCv37 13 96,120,739 - 96,120,841 UniSTS GRCm37 Celera 13 98,972,136 - 98,972,238 UniSTS Cytogenetic Map 13 D1 UniSTS Whitehead/MRC_RH 13 831.49 UniSTS
Aggf1
Mouse Assembly Chr Position (strand) Source JBrowse GRCm38 13 95,350,760 - 95,351,329 UniSTS GRCm38 MGSCv37 13 96,120,715 - 96,121,284 UniSTS GRCm37 Celera 13 98,972,112 - 98,972,681 UniSTS Cytogenetic Map 13 D1 UniSTS cM Map 13 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000022189 ⟹ ENSMUSP00000022189
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 95,487,191 - 95,511,860 (-) Ensembl GRCm38.p6 Ensembl 13 95,350,683 - 95,375,352 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000161671
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 95,490,010 - 95,511,842 (-) Ensembl GRCm38.p6 Ensembl 13 95,353,502 - 95,375,334 (-) Ensembl
RefSeq Acc Id:
NM_025630 ⟹ NP_079906
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 95,487,191 - 95,511,865 (-) NCBI GRCm38 13 95,350,683 - 95,375,357 (-) NCBI MGSCv37 13 96,120,671 - 96,145,289 (-) RGD Celera 13 98,972,035 - 98,996,710 (-) NCBI cM Map 13 ENTREZGENE
Sequence:
CCGGCTCAGCCCGGAACTAGAGGCTTCCGCTGGGTTCGCTTTAGTTCTCCCGTCCGCTGGCTTCCCGGAGACTGTCACCGGGCGGGTGTCCGCGCGGCCCGGGTAGAGTCGGCTTCGTCCCCAAGCTC
hide sequence
RefSeq Acc Id:
NP_079906 ⟸ NM_025630
- UniProtKB:
Q9CU87 (UniProtKB/Swiss-Prot), Q9CQR9 (UniProtKB/Swiss-Prot), Q8R2S6 (UniProtKB/Swiss-Prot), Q9D768 (UniProtKB/Swiss-Prot), Q7TN31 (UniProtKB/Swiss-Prot), Q3V1B3 (UniProtKB/TrEMBL)
- Sequence:
MASEAPSPPSPSPPPPASPEPELAQLRRKVEKLERELRSCRRQVREVEKLLQHTERLYRNAESDNQELRTQVEELSKILHCGKNEDNPKSDVEVQTESQAPWAISDYYYQTCYNDDSLPSKETELCVQ
hide sequence
Ensembl Acc Id:
ENSMUSP00000022189 ⟸ ENSMUST00000022189
RGD ID: 8681050 Promoter ID: EPDNEW_M18556 Type: initiation region Name: Aggf1_1 Description: Mus musculus angiogenic factor with G patch and FHA domains 1, mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 13 95,375,315 - 95,375,375 EPDNEW
RGD ID: 6823633 Promoter ID: MM_KWN:14956 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day0, 3T3L1_Day1, 3T3L1_Day2, 3T3L1_Day3, 3T3L1_Day4, 3T3L1_Day6, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: OTTMUST00000076097, OTTMUST00000076098 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 13 96,145,101 - 96,145,601 (-) MPROMDB
