Advanced Search (OLGA)

Gene: MIR380 (microRNA 380) Homo sapiens

Subscribe to Updates

Analyze

Symbol:

MIR380

Name:

microRNA 380

RGD ID:

1350037

HGNC Page

HGNC:31873

Description:

Predicted to be involved in energy homeostasis. Predicted to act upstream of or within cellular response to leukemia inhibitory factor.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

hsa-mir-380; mir-380; MIR380-3p; MIRN380

RGD Orthologs

Mouse

Alliance Orthologs

More Info

more info ...

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	14	101,025,017 - 101,025,077 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	14	101,025,017 - 101,025,077 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	14	101,491,354 - 101,491,414 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	14	100,561,106 - 100,561,166 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	14	81,547,386 - 81,547,446 (+)	NCBI		Celera
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	81,674,837 - 81,674,897 (+)	NCBI		HuRef
CHM1_1	14	101,429,490 - 101,429,550 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	14	95,260,461 - 95,260,521 (+)	NCBI		T2T-CHM13v2.0

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MIR380	Human	Kagami-Ogata syndrome		IAGP	(Homo sapiens)	8554872	ClinVar Annotator: match by term: Paternal uniparental disomy 14	ClinVar	PMID:18176563

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MIR380	Human	adult respiratory distress syndrome		EXP		11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:25070658
MIR380	Human	Cocaine-Related Disorders		EXP		11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:20643829
MIR380	Human	papillary thyroid carcinoma		EXP		11554173	CTD Direct Evidence: marker/mechanism	CTD	PMID:28030816

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MIR380	Human	1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	NFE2L2 protein affects the reaction [1-Methyl-4-phenyl-1 more ...	CTD	PMID:29071302
MIR380	Human	1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine	decreases expression	ISO	Mir380 (Mus musculus)	6480464	1-Methyl-4-phenyl-1 more ...	CTD	PMID:29071302
MIR380	Human	17beta-estradiol	increases expression	EXP		6480464	Estradiol results in increased expression of MIR380 mRNA	CTD	PMID:22113133
MIR380	Human	2-tert-butylhydroquinone	increases expression	ISO	Mir380 (Mus musculus)	6480464	2-tert-butylhydroquinone results in increased expression of MIR380	CTD	PMID:31368498
MIR380	Human	2-tert-butylhydroquinone	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	Paraquat inhibits the reaction [2-tert-butylhydroquinone results in increased expression of MIR380]	CTD	PMID:31368498
MIR380	Human	benzene	increases expression	ISO	Mir380 (Mus musculus)	6480464	Benzene results in increased expression of MIR380 mRNA	CTD	PMID:32105654
MIR380	Human	benzo[a]pyrene	affects methylation	EXP		6480464	Benzo(a)pyrene affects the methylation of MIR380 promoter	CTD	PMID:27901495
MIR380	Human	cadmium atom	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MIR380 mRNA	CTD	PMID:28892167
MIR380	Human	cadmium dichloride	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	[Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of MIR380 mRNA	CTD	PMID:28892167
MIR380	Human	cocaine	increases expression	ISO	Mir380 (Mus musculus)	6480464	Cocaine results in increased expression of MIR380 mRNA	CTD	PMID:20643829
MIR380	Human	cocaine	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	AGO2 protein affects the reaction [Cocaine results in increased expression of MIR380 mRNA]	CTD	PMID:20643829
MIR380	Human	Diosbulbin B	increases expression	ISO	Mir380 (Mus musculus)	6480464	diosbulbin B results in increased expression of MIR380 mRNA	CTD	PMID:28844483
MIR380	Human	methylisothiazolinone	increases expression	EXP		6480464	2-methyl-4-isothiazolin-3-one results in increased expression of MIR380 mRNA	CTD	PMID:31629900
MIR380	Human	monocrotaline	decreases expression	ISO	Mir380 (Mus musculus)	6480464	Monocrotaline results in decreased expression of MIR380 mRNA	CTD	PMID:28818515
MIR380	Human	p-cresol	increases expression	ISO	Mir380 (Mus musculus)	6480464	4-cresol results in increased expression of MIR380 mRNA	CTD	PMID:32105654
MIR380	Human	paraquat	multiple interactions	ISO	Mir380 (Mus musculus)	6480464	NFE2L2 protein affects the reaction [Paraquat affects the expression of MIR380 mRNA] more ...	CTD	PMID:29071302 and PMID:31368498
MIR380	Human	paraquat	affects expression	ISO	Mir380 (Mus musculus)	6480464	Paraquat affects the expression of MIR380 mRNA	CTD	PMID:29071302
MIR380	Human	paraquat	decreases expression	ISO	Mir380 (Mus musculus)	6480464	Paraquat results in decreased expression of MIR380	CTD	PMID:31368498
MIR380	Human	paraquat	increases response to substance	ISO	Mir380 (Mus musculus)	6480464	MIR380 results in increased susceptibility to Paraquat	CTD	PMID:31368498
MIR380	Human	phenobarbital	affects expression	ISO	Mir380 (Mus musculus)	6480464	Phenobarbital affects the expression of MIR380 mRNA	CTD	PMID:23091169
MIR380	Human	phenol	increases expression	ISO	Mir380 (Mus musculus)	6480464	Phenol results in increased expression of MIR380 mRNA	CTD	PMID:32105654
MIR380	Human	propiconazole	decreases expression	ISO	Mir380 (Mus musculus)	6480464	propiconazole results in decreased expression of MIR380 mRNA	CTD	PMID:20175128
MIR380	Human	streptozocin	increases expression	ISO	Mir380 (Mus musculus)	6480464	Streptozocin results in increased expression of MIR380 mRNA	CTD	PMID:27629361
MIR380	Human	triadimefon	decreases expression	ISO	Mir380 (Mus musculus)	6480464	triadimefon results in decreased expression of MIR380 mRNA	CTD	PMID:20175128

Biological Process

Only show annotations with direct experimental evidence (0 objects hidden)

Object Symbol	Species	Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
MIR380	Human	cellular response to leukemia inhibitory factor	acts_upstream_of_or_within	ISO	Mir380 (Mus musculus)	9068941	PMID:20439489	MGI	PMID:20439489
MIR380	Human	energy homeostasis	involved_in	ISO	Mir380 (Mus musculus)	9068941	PMID:25124681	MGI	PMID:25124681

#	Reference Title	Reference Citation
1.	ClinVar Automated Import and Annotation Pipeline	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

PMID:15310658	PMID:15538371	PMID:16381832	PMID:17604727	PMID:20871609	PMID:21037258	PMID:27835701	PMID:29743236	PMID:31821848	PMID:35758158	PMID:38220171

MIR380
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	14	101,025,017 - 101,025,077 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	14	101,025,017 - 101,025,077 (+)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	14	101,491,354 - 101,491,414 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	14	100,561,106 - 100,561,166 (+)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	14	81,547,386 - 81,547,446 (+)	NCBI		Celera
Cytogenetic Map	14	q32.31	NCBI
HuRef	14	81,674,837 - 81,674,897 (+)	NCBI		HuRef
CHM1_1	14	101,429,490 - 101,429,550 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	14	95,260,461 - 95,260,521 (+)	NCBI		T2T-CHM13v2.0

Mir380
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	12	109,678,237 - 109,678,297 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	12	109,678,237 - 109,678,297 (+)	Ensembl		GRCm39 Ensembl
GRCm38	12	109,711,803 - 109,711,863 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	12	109,711,803 - 109,711,863 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	12	110,950,013 - 110,950,073 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	12	110,909,029 - 110,909,089 (+)	NCBI		Celera
Cytogenetic Map	12	F1	NCBI
cM Map	12	60.56	NCBI

Name	Type	Condition(s)	Position(s)	Clinical significance
GRCh38/hg38 14q32.2-32.33(chr14:100309382-106855263)x1	copy number loss	See cases [RCV000050938]	Chr14:100309382..106855263 [GRCh38] Chr14:100775719..107263478 [GRCh37] Chr14:99845472..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:97938637-106855263)x1	copy number loss	See cases [RCV000050696]	Chr14:97938637..106855263 [GRCh38] Chr14:98404974..107263478 [GRCh37] Chr14:97474727..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100590353-106855264)x1	copy number loss	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051553]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051553]\|See cases [RCV000051553]	Chr14:100590353..106855264 [GRCh38] Chr14:101056690..107263479 [GRCh37] Chr14:100126443..106334524 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100808300-106855263)x1	copy number loss	See cases [RCV000051113]	Chr14:100808300..106855263 [GRCh38] Chr14:101274637..107263478 [GRCh37] Chr14:100344390..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q31.2-32.33(chr14:83912345-106855405)x3	copy number gain	See cases [RCV000052294]	Chr14:83912345..106855405 [GRCh38] Chr14:84378689..107263620 [GRCh37] Chr14:83448442..106334665 [NCBI36] Chr14:14q31.2-32.33	pathogenic
GRCh38/hg38 14q31.3-32.33(chr14:86094030-106832642)x3	copy number gain	See cases [RCV000052295]	Chr14:86094030..106832642 [GRCh38] Chr14:86560374..107240869 [GRCh37] Chr14:85630127..106311914 [NCBI36] Chr14:14q31.3-32.33	pathogenic
GRCh38/hg38 14q32.13-32.33(chr14:94628219-106451054)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052298]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052298]\|See cases [RCV000052298]	Chr14:94628219..106451054 [GRCh38] Chr14:95094556..106906960 [GRCh37] Chr14:94164309..105978005 [NCBI36] Chr14:14q32.13-32.33	pathogenic
GRCh38/hg38 14q32.12-32.33(chr14:91455861-106832642)x3	copy number gain	See cases [RCV000052296]	Chr14:91455861..106832642 [GRCh38] Chr14:91922205..107240869 [GRCh37] Chr14:90991958..106311914 [NCBI36] Chr14:14q32.12-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:99831655-106855263)x1	copy number loss	See cases [RCV000133831]	Chr14:99831655..106855263 [GRCh38] Chr14:100297992..107263478 [GRCh37] Chr14:99367745..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q24.3-32.33(chr14:73655772-106879298)x3	copy number gain	See cases [RCV000134000]	Chr14:73655772..106879298 [GRCh38] Chr14:74122475..107287505 [GRCh37] Chr14:73192228..106358550 [NCBI36] Chr14:14q24.3-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100309382-105987610)x3	copy number gain	See cases [RCV000135410]	Chr14:100309382..105987610 [GRCh38] Chr14:100775719..106453697 [GRCh37] Chr14:99845472..105524742 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:97638520-106855263)x3	copy number gain	See cases [RCV000135400]	Chr14:97638520..106855263 [GRCh38] Chr14:98104857..107263478 [GRCh37] Chr14:97174610..106334523 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:99448012-106850609)x3	copy number gain	See cases [RCV000135875]	Chr14:99448012..106850609 [GRCh38] Chr14:99914349..107258824 [GRCh37] Chr14:98984102..106329869 [NCBI36] Chr14:14q32.2-32.33	pathogenic
GRCh38/hg38 14q11.2-32.33(chr14:20151149-106855263)x3	copy number gain	See cases [RCV000135543]	Chr14:20151149..106855263 [GRCh38] Chr14:20619308..107263478 [GRCh37] Chr14:19689148..106334523 [NCBI36] Chr14:14q11.2-32.33	pathogenic
GRCh38/hg38 14q32.12-32.33(chr14:92540983-104863658)x3	copy number gain	See cases [RCV000135896]	Chr14:92540983..104863658 [GRCh38] Chr14:93007328..105329995 [GRCh37] Chr14:92077081..104401040 [NCBI36] Chr14:14q32.12-32.33	pathogenic
GRCh38/hg38 14q32.13-32.33(chr14:95524407-106879501)x1	copy number loss	See cases [RCV000136032]	Chr14:95524407..106879501 [GRCh38] Chr14:95990744..107287708 [GRCh37] Chr14:95060497..106358753 [NCBI36] Chr14:14q32.13-32.33	pathogenic
GRCh38/hg38 14q24.3-32.33(chr14:77222795-106879298)x3	copy number gain	See cases [RCV000138230]	Chr14:77222795..106879298 [GRCh38] Chr14:77689138..107287505 [GRCh37] Chr14:76758891..106358550 [NCBI36] Chr14:14q24.3-32.33	pathogenic
GRCh38/hg38 14q32.2-32.31(chr14:100262836-102500697)x1	copy number loss	See cases [RCV000139723]	Chr14:100262836..102500697 [GRCh38] Chr14:100729173..102967034 [GRCh37] Chr14:99798926..102036787 [NCBI36] Chr14:14q32.2-32.31	pathogenic
GRCh38/hg38 14q11.2-32.33(chr14:20043514-106877229)x3	copy number gain	See cases [RCV000143373]	Chr14:20043514..106877229 [GRCh38] Chr14:20511673..107285437 [GRCh37] Chr14:19581513..106356482 [NCBI36] Chr14:14q11.2-32.33	pathogenic
GRCh38/hg38 14q32.2-32.33(chr14:100582059-106877229)x1	copy number loss	See cases [RCV000143662]	Chr14:100582059..106877229 [GRCh38] Chr14:101048396..107285437 [GRCh37] Chr14:100118149..106356482 [NCBI36] Chr14:14q32.2-32.33	pathogenic
NC_000014.9:g.100806482_101281031del474550	deletion	Paternal uniparental disomy of chromosome 14 [RCV000149429]	Chr14:100806482..101281031 [GRCh38] Chr14:101272819..101747368 [GRCh37] Chr14:14q32.2-32.31	pathogenic
GRCh37/hg19 14q32.2-32.33(chr14:100575917-107281934)	copy number gain	not provided [RCV000767752]	Chr14:100575917..107281934 [GRCh37] Chr14:14q32.2-32.33	pathogenic
GRCh37/hg19 14q32.31(chr14:101468366-101979522)x3	copy number gain	See cases [RCV000449250]	Chr14:101468366..101979522 [GRCh37] Chr14:14q32.31	uncertain significance
GRCh37/hg19 14q32.2-32.33(chr14:98051841-107285437)x3	copy number gain	See cases [RCV000446497]	Chr14:98051841..107285437 [GRCh37] Chr14:14q32.2-32.33	likely pathogenic
GRCh37/hg19 14q11.2-32.33(chr14:19794561-107234280)x3	copy number gain	See cases [RCV000446256]	Chr14:19794561..107234280 [GRCh37] Chr14:14q11.2-32.33	pathogenic
GRCh37/hg19 14q23.2-32.33(chr14:62493932-107285437)x3	copy number gain	See cases [RCV000448557]	Chr14:62493932..107285437 [GRCh37] Chr14:14q23.2-32.33	pathogenic
GRCh37/hg19 14q11.2-32.33(chr14:20511673-107285437)	copy number gain	See cases [RCV000512041]	Chr14:20511673..107285437 [GRCh37] Chr14:14q11.2-32.33	pathogenic
GRCh37/hg19 14q32.2-32.33(chr14:100661319-107285437)x1	copy number loss	See cases [RCV000511171]	Chr14:100661319..107285437 [GRCh37] Chr14:14q32.2-32.33	pathogenic
GRCh37/hg19 14q24.2-32.33(chr14:73750741-107285437)x3	copy number gain	See cases [RCV000512497]	Chr14:73750741..107285437 [GRCh37] Chr14:14q24.2-32.33	pathogenic
GRCh37/hg19 14q11.1-32.33(chr14:19000422-107289053)x3	copy number gain	not provided [RCV000738412]	Chr14:19000422..107289053 [GRCh37] Chr14:14q11.1-32.33	pathogenic
GRCh37/hg19 14q11.2-32.33(chr14:19280733-107287663)x3	copy number gain	not provided [RCV000738413]	Chr14:19280733..107287663 [GRCh37] Chr14:14q11.2-32.33	pathogenic
GRCh37/hg19 14q11.2-32.33(chr14:19327823-107287663)x3	copy number gain	not provided [RCV000738414]	Chr14:19327823..107287663 [GRCh37] Chr14:14q11.2-32.33	pathogenic
GRCh37/hg19 14q32.12-32.33(chr14:91969028-107285437)x3	copy number gain	not provided [RCV000848687]	Chr14:91969028..107285437 [GRCh37] Chr14:14q32.12-32.33	pathogenic
GRCh37/hg19 14q32.2-32.31(chr14:99737888-101847855)	copy number gain	not provided [RCV000767823]	Chr14:99737888..101847855 [GRCh37] Chr14:14q32.2-32.31	likely pathogenic
GRCh37/hg19 14q32.2-32.33(chr14:99794230-107285437)x3	copy number gain	not provided [RCV000849272]	Chr14:99794230..107285437 [GRCh37] Chr14:14q32.2-32.33	pathogenic
GRCh37/hg19 14q31.2-32.33(chr14:84537502-107285437)x3	copy number gain	not provided [RCV002472581]	Chr14:84537502..107285437 [GRCh37] Chr14:14q31.2-32.33	pathogenic
GRCh37/hg19 14q32.2-32.33(chr14:96829290-107287663)x1	copy number loss	See cases [RCV001195078]	Chr14:96829290..107287663 [GRCh37] Chr14:14q32.2-32.33	pathogenic
GRCh37/hg19 14q32.13-32.31(chr14:95871795-102457523)x1	copy number loss	not provided [RCV001827727]	Chr14:95871795..102457523 [GRCh37] Chr14:14q32.13-32.31	pathogenic
GRCh37/hg19 14q13.3-32.33(chr14:37671058-106985955)x2	copy number gain	See cases [RCV002286356]	Chr14:37671058..106985955 [GRCh37] Chr14:14q13.3-32.33	pathogenic
GRCh37/hg19 14q32.2-32.31(chr14:100397006-101488936)x1	copy number loss	Motor developmental delay due to 14q32.2 paternally expressed gene defect [RCV003325926]	Chr14:100397006..101488936 [GRCh37] Chr14:14q32.2-32.31	pathogenic
GRCh37/hg19 14q31.3-32.33(chr14:88580184-107285437)x3	copy number gain	not provided [RCV003485051]	Chr14:88580184..107285437 [GRCh37] Chr14:14q31.3-32.33	pathogenic
GRCh37/hg19 14q32.2-32.33(chr14:101024609-107285437)x1	copy number loss	not provided [RCV003483217]	Chr14:101024609..107285437 [GRCh37] Chr14:14q32.2-32.33	pathogenic
GRCh37/hg19 14q23.1-32.33(chr14:58894502-107227240)x3	copy number gain	not provided [RCV003485036]	Chr14:58894502..107227240 [GRCh37] Chr14:14q23.1-32.33	pathogenic
GRCh37/hg19 14q32.2-32.32(chr14:97705251-103682578)x3	copy number gain	not specified [RCV003987047]	Chr14:97705251..103682578 [GRCh37] Chr14:14q32.2-32.32	uncertain significance

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
TP53	hsa-miR-380-5p	OncomiRDB	external_info	NA	NA	20871609

Predicted Targets

	Summary Value
Count of predictions:	20260
Count of gene targets:	8295
Count of transcripts:	15228
Interacting mature miRNAs:	hsa-miR-380-3p, hsa-miR-380-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

adipose tissue	alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	entire extraembryonic component	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	musculoskeletal system	nervous system	renal system	reproductive system	respiratory system
1	3	4	4	36	11	14	1	1	16	1	7	30	25	5	38	4	15	12


RefSeq Transcripts	NG_045000	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_029872	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL132709	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CP068264	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608706	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENST00000362112

Type:

CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38.p14 Ensembl	14	101,025,017 - 101,025,077 (+)	Ensembl

RefSeq Acc Id:

NR_029872

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	14	101,025,017 - 101,025,077 (+)	NCBI
GRCh37	14	101,491,354 - 101,491,414 (+)	RGD
Celera	14	81,547,386 - 81,547,446 (+)	RGD
HuRef	14	81,674,837 - 81,674,897 (+)	ENTREZGENE
CHM1_1	14	101,429,490 - 101,429,550 (+)	NCBI
T2T-CHM13v2.0	14	95,260,461 - 95,260,521 (+)	NCBI

Sequence:

show sequence

AAGATGGTTGACCATAGAACATGCGCTATCTCTGTGTCGTATGTAATATGGTCCACATCTT

hide sequence

Database	Acc Id	Source(s)
COSMIC	MIR380	COSMIC
Ensembl Genes	ENSG00000198982	Ensembl, ENTREZGENE
Ensembl Transcript	ENST00000362112	ENTREZGENE
GTEx	ENSG00000198982	GTEx
HGNC ID	HGNC:31873	ENTREZGENE
Human Proteome Map	MIR380	Human Proteome Map
miRBase	MI0000788	ENTREZGENE
NCBI Gene	494329	ENTREZGENE
OMIM	613654	OMIM
PharmGKB	PA164722699	PharmGKB
RNAcentral	URS00002CAE0C	RNACentral
	URS000075BE5F	RNACentral
	URS000075D37E	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailable


InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailable


Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
		Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD

Send us a Message

Imported Disease Annotations - ClinVar

Imported Disease Annotations - CTD