Symbol:
BAG2
Name:
BAG cochaperone 2
RGD ID:
1343744
HGNC Page
HGNC:938
Description:
Enables several functions, including adenyl-nucleotide exchange factor activity; identical protein binding activity; and transmembrane transporter binding activity. Involved in negative regulation of protein ubiquitination; positive regulation of protein processing; and protein stabilization. Part of protein folding chaperone complex.
Type:
protein-coding
RefSeq Status:
REVIEWED
Previously known as:
BAG family molecular chaperone regulator 2; BAG-2; BAG-family molecular chaperone regulator-2; bcl-2-associated athanogene 2; BCL2 associated athanogene 2; BCL2-associated athanogene 2; dJ417I1.2; dJ417I1.2 (BAG-family molecular chaperone regulator 2); KIAA0576; MGC149462
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Mus musculus (house mouse):
Bag2 (BCL2-associated athanogene 2) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Bag2 (BAG cochaperone 2) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Chinchilla lanigera (long-tailed chinchilla):
Bag2 (BAG cochaperone 2) NCBI
Ortholog
Pan paniscus (bonobo/pygmy chimpanzee):
BAG2 (BAG cochaperone 2) NCBI
Ortholog
Canis lupus familiaris (dog):
BAG2 (BAG cochaperone 2) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, Treefam
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Bag2 (BAG cochaperone 2) NCBI
Ortholog
Sus scrofa (pig):
BAG2 (BAG cochaperone 2) HGNC
Ensembl, NCBI, OrthoDB
Chlorocebus sabaeus (green monkey):
BAG2 (BAG cochaperone 2) NCBI
Ortholog
Heterocephalus glaber (naked mole-rat):
Bag2 (BAG cochaperone 2) NCBI
Ortholog
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Bag2 (BAG cochaperone 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Bag2 (BCL2-associated athanogene 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
bag2 (BCL2 associated athanogene 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Drosophila melanogaster (fruit fly):
CG7945
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Caenorhabditis elegans (roundworm):
unc-23
Alliance
DIOPT (Ensembl Compara|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB)
Xenopus tropicalis (tropical clawed frog):
bag2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus laevis (African clawed frog):
bag2.S
Alliance
DIOPT (Xenbase)
Xenopus laevis (African clawed frog):
bag2.L
Alliance
DIOPT (Xenbase)
Allele / Splice:
See ClinVar data
Latest Assembly:
GRCh38 - Human Genome Assembly GRCh38
Position:
Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 57,172,326 - 57,189,833 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 57,172,326 - 57,189,833 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 57,037,124 - 57,054,631 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 57,145,293 - 57,157,694 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 57,145,292 - 57,157,692 NCBI Celera 6 58,700,203 - 58,713,112 (+) NCBI Celera Cytogenetic Map 6 p12.1 NCBI HuRef 6 56,871,161 - 56,884,070 (+) NCBI HuRef CHM1_1 6 57,037,430 - 57,050,339 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 57,011,351 - 57,028,858 (+) NCBI T2T-CHM13v2.0
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
BAG2 Human (+)-schisandrin B multiple interactions ISO Bag2 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of BAG2 mRNA] CTD PMID:31150632 BAG2 Human (-)-epigallocatechin 3-gallate multiple interactions EXP 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of BAG2 mRNA CTD PMID:22079256 BAG2 Human 1,2-dimethylhydrazine increases expression ISO Bag2 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of BAG2 mRNA CTD PMID:22206623 BAG2 Human 17beta-estradiol affects expression ISO Bag2 (Mus musculus) 6480464 Estradiol affects the expression of BAG2 mRNA CTD PMID:15598610 BAG2 Human 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of BAG2 mRNA CTD PMID:20106945 and PMID:24758408 BAG2 Human 17beta-estradiol multiple interactions EXP 6480464 EGF protein promotes the reaction [Estradiol results in increased expression of BAG2 mRNA] CTD PMID:24758408 BAG2 Human 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Bag2 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of BAG2 mRNA CTD PMID:34747641 BAG2 Human 2-amino-14,16-dimethyloctadecan-3-ol decreases expression EXP 6480464 2-amino-14 and 16-dimethyloctadecan-3-ol results in decreased expression of BAG2 protein CTD PMID:32044396 BAG2 Human 3-chloropropane-1,2-diol increases expression ISO Bag2 (Rattus norvegicus) 6480464 alpha-Chlorohydrin results in increased expression of BAG2 protein CTD PMID:34915118 BAG2 Human 3-isobutyl-1-methyl-7H-xanthine multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of BAG2 mRNA CTD PMID:28628672 BAG2 Human 4,4'-diaminodiphenylmethane decreases expression ISO Bag2 (Mus musculus) 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of BAG2 mRNA CTD PMID:18648102 BAG2 Human 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of BAG2 protein CTD PMID:34186270 BAG2 Human 4-\{[(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)carbonyl]amino\}benzoic acid increases expression EXP 6480464 Am 580 results in increased expression of BAG2 mRNA CTD PMID:16982809 BAG2 Human 4-hydroxyphenyl retinamide increases expression ISO Bag2 (Mus musculus) 6480464 Fenretinide results in increased expression of BAG2 mRNA CTD PMID:28973697 BAG2 Human 5-aza-2'-deoxycytidine multiple interactions EXP 6480464 TP53 protein affects the reaction [Decitabine results in decreased expression of BAG2 mRNA] CTD PMID:19363521 BAG2 Human 5-aza-2'-deoxycytidine decreases expression EXP 6480464 Decitabine results in decreased expression of BAG2 mRNA CTD PMID:19363521 BAG2 Human acetamide decreases expression ISO Bag2 (Rattus norvegicus) 6480464 acetamide results in decreased expression of BAG2 mRNA CTD PMID:31881176 BAG2 Human acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of BAG2 mRNA CTD PMID:32763439 BAG2 Human aflatoxin B1 decreases expression ISO Bag2 (Mus musculus) 6480464 Aflatoxin B1 results in decreased expression of BAG2 mRNA CTD PMID:19770486 BAG2 Human aflatoxin B1 decreases methylation EXP 6480464 Aflatoxin B1 results in decreased methylation of BAG2 gene CTD PMID:27153756 BAG2 Human aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of BAG2 mRNA CTD PMID:27153756 BAG2 Human all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of BAG2 mRNA CTD PMID:21934132 BAG2 Human all-trans-retinoic acid decreases expression EXP 6480464 Tretinoin results in decreased expression of BAG2 mRNA CTD PMID:33167477 BAG2 Human aristolochic acid A decreases expression EXP 6480464 aristolochic acid I results in decreased expression of BAG2 mRNA CTD PMID:33212167 BAG2 Human arsane multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human arsenic atom multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human arsenite(3-) multiple interactions EXP 6480464 arsenite promotes the reaction [G3BP1 protein binds to BAG2 protein] CTD PMID:32406909 BAG2 Human atrazine decreases expression ISO Bag2 (Rattus norvegicus) 6480464 Atrazine results in decreased expression of BAG2 mRNA CTD PMID:36841081 BAG2 Human belinostat multiple interactions EXP 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human belinostat increases expression EXP 6480464 belinostat results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of BAG2 mRNA CTD PMID:22316170 BAG2 Human benzo[a]pyrene increases expression ISO Bag2 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of BAG2 mRNA CTD PMID:22228805 BAG2 Human benzo[a]pyrene diol epoxide I decreases expression EXP 6480464 7 more ... CTD PMID:19150397 and PMID:20382639 BAG2 Human bis(2-ethylhexyl) phthalate decreases expression ISO Bag2 (Mus musculus) 6480464 Diethylhexyl Phthalate results in decreased expression of BAG2 mRNA CTD PMID:34319233 BAG2 Human bisphenol A increases expression ISO Bag2 (Mus musculus) 6480464 bisphenol A results in increased expression of BAG2 mRNA and bisphenol A results in increased expression of BAG2 protein CTD PMID:15215581 and PMID:34585602 BAG2 Human bisphenol A increases expression ISO Bag2 (Rattus norvegicus) 6480464 bisphenol A results in increased expression of BAG2 mRNA CTD PMID:34947998 BAG2 Human bisphenol A multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of BAG2 mRNA CTD PMID:28628672 BAG2 Human bisphenol A affects expression ISO Bag2 (Rattus norvegicus) 6480464 bisphenol A affects the expression of BAG2 mRNA CTD PMID:25181051 BAG2 Human bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of BAG2 mRNA and bisphenol A results in decreased expression of BAG2 protein CTD PMID:25047013 and PMID:34186270 BAG2 Human bisphenol AF increases expression EXP 6480464 bisphenol AF results in increased expression of BAG2 protein CTD PMID:34186270 BAG2 Human Bisphenol B increases expression EXP 6480464 bisphenol B results in increased expression of BAG2 protein CTD PMID:34186270 BAG2 Human bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of BAG2 protein CTD PMID:34186270 BAG2 Human cadmium atom increases expression EXP 6480464 Cadmium results in increased expression of BAG2 mRNA CTD PMID:23369406 BAG2 Human cadmium atom multiple interactions ISO Bag2 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of BAG2 mRNA CTD PMID:37325564 BAG2 Human cadmium dichloride multiple interactions ISO Bag2 (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of BAG2 mRNA CTD PMID:37325564 BAG2 Human calcitriol decreases expression EXP 6480464 Calcitriol results in decreased expression of BAG2 mRNA CTD PMID:26485663 BAG2 Human carbamazepine affects expression EXP 6480464 Carbamazepine affects the expression of BAG2 mRNA CTD PMID:25979313 BAG2 Human CCCP multiple interactions EXP 6480464 BAG2 protein affects the reaction [Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased lipidation of MAP1LC3B protein] and BAG2 protein inhibits the reaction [Doxorubicin inhibits the reaction [Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased lipidation of MAP1LC3B protein]] CTD PMID:39442788 BAG2 Human chlordecone increases expression ISO Bag2 (Mus musculus) 6480464 Chlordecone results in increased expression of BAG2 mRNA CTD PMID:29980752 BAG2 Human chromium(6+) affects expression ISO Bag2 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of BAG2 mRNA CTD PMID:28472532 BAG2 Human cobalt dichloride increases expression ISO Bag2 (Rattus norvegicus) 6480464 cobaltous chloride results in increased expression of BAG2 mRNA CTD PMID:24386269 BAG2 Human coumestrol increases expression EXP 6480464 Coumestrol results in increased expression of BAG2 mRNA CTD PMID:19167446 BAG2 Human coumestrol multiple interactions EXP 6480464 [Coumestrol co-treated with resveratrol] results in increased expression of BAG2 mRNA CTD PMID:19167446 BAG2 Human Cuprizon decreases expression ISO Bag2 (Rattus norvegicus) 6480464 Cuprizone results in decreased expression of BAG2 mRNA CTD PMID:26577399 BAG2 Human cyclosporin A increases expression EXP 6480464 Cyclosporine results in increased expression of BAG2 mRNA CTD PMID:20106945 and PMID:25562108 BAG2 Human DDE increases expression EXP 6480464 Dichlorodiphenyl Dichloroethylene results in increased expression of BAG2 mRNA CTD PMID:38568856 BAG2 Human dexamethasone multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of BAG2 mRNA CTD PMID:28628672 BAG2 Human Dibutyl phosphate affects expression EXP 6480464 di-n-butylphosphoric acid affects the expression of BAG2 mRNA CTD PMID:37042841 BAG2 Human dibutyl phthalate increases expression ISO Bag2 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of BAG2 mRNA CTD PMID:21266533 BAG2 Human dibutyl phthalate increases expression ISO Bag2 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of BAG2 mRNA CTD PMID:21266533 BAG2 Human dichloroacetic acid increases expression ISO Bag2 (Mus musculus) 6480464 Dichloroacetic Acid results in increased expression of BAG2 mRNA CTD PMID:28962523 BAG2 Human dioxygen decreases expression EXP 6480464 Oxygen deficiency results in decreased expression of BAG2 mRNA CTD PMID:35883890 BAG2 Human diquat increases expression ISO Bag2 (Mus musculus) 6480464 Diquat results in increased expression of BAG2 mRNA and Diquat results in increased expression of BAG2 protein CTD PMID:36851058 BAG2 Human dorsomorphin multiple interactions EXP 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 BAG2 Human doxorubicin multiple interactions EXP 6480464 BAG2 protein inhibits the reaction [Doxorubicin inhibits the reaction [Carbonyl Cyanide m-Chlorophenyl Hydrazone results in increased lipidation of MAP1LC3B protein]] CTD PMID:39442788 BAG2 Human doxorubicin decreases expression ISO Bag2 (Mus musculus) 6480464 Doxorubicin results in decreased expression of BAG2 protein CTD PMID:39442788 BAG2 Human doxorubicin decreases expression EXP 6480464 Doxorubicin results in decreased expression of BAG2 protein CTD PMID:39442788 BAG2 Human entinostat multiple interactions EXP 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human entinostat increases expression EXP 6480464 entinostat results in increased expression of BAG2 mRNA CTD PMID:26272509 and PMID:27188386 BAG2 Human enzyme inhibitor multiple interactions EXP 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of BAG2 protein CTD PMID:23301498 BAG2 Human ethyl methanesulfonate decreases expression EXP 6480464 Ethyl Methanesulfonate results in decreased expression of BAG2 mRNA CTD PMID:23649840 BAG2 Human etoposide affects response to substance EXP 6480464 BAG2 protein affects the susceptibility to Etoposide CTD PMID:16217747 BAG2 Human folic acid decreases expression ISO Bag2 (Mus musculus) 6480464 Folic Acid results in decreased expression of BAG2 mRNA CTD PMID:25629700 BAG2 Human FR900359 affects phosphorylation EXP 6480464 FR900359 affects the phosphorylation of BAG2 protein CTD PMID:37730182 BAG2 Human gentamycin increases expression ISO Bag2 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of BAG2 mRNA CTD PMID:22061828 BAG2 Human hydrogen peroxide affects expression EXP 6480464 Hydrogen Peroxide affects the expression of BAG2 mRNA CTD PMID:20044591 BAG2 Human hydrogen peroxide increases expression EXP 6480464 Hydrogen Peroxide results in increased expression of BAG2 protein CTD PMID:34581912 BAG2 Human indometacin multiple interactions EXP 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of BAG2 mRNA CTD PMID:28628672 BAG2 Human ivermectin decreases expression EXP 6480464 Ivermectin results in decreased expression of BAG2 protein CTD PMID:32959892 BAG2 Human leflunomide decreases expression EXP 6480464 leflunomide results in decreased expression of BAG2 mRNA CTD PMID:28988120 BAG2 Human manganese atom multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human manganese(0) multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human manganese(II) chloride multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human mercury dibromide increases expression EXP 6480464 mercuric bromide results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human mercury dibromide multiple interactions EXP 6480464 [NOG protein co-treated with mercuric bromide co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human mercury dichloride increases expression ISO Bag2 (Rattus norvegicus) 6480464 Mercuric Chloride results in increased expression of BAG2 mRNA CTD PMID:16507785 BAG2 Human methyl methanesulfonate decreases expression EXP 6480464 Methyl Methanesulfonate results in decreased expression of BAG2 mRNA CTD PMID:23649840 BAG2 Human methylmercury chloride increases expression EXP 6480464 methylmercuric chloride results in increased expression of BAG2 mRNA CTD PMID:23179753 more ... BAG2 Human methylmercury chloride multiple interactions EXP 6480464 [NOG protein co-treated with methylmercuric chloride co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human methylparaben decreases expression EXP 6480464 methylparaben results in decreased expression of BAG2 mRNA CTD PMID:31745603 BAG2 Human N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal multiple interactions EXP 6480464 BAG2 protein inhibits the reaction [benzyloxycarbonylleucyl-leucyl-leucine aldehyde results in increased expression of PINK1 protein] CTD PMID:39442788 BAG2 Human oxaliplatin multiple interactions ISO Bag2 (Rattus norvegicus) 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of BAG2 mRNA CTD PMID:25729387 BAG2 Human p-chloromercuribenzoic acid increases expression EXP 6480464 p-Chloromercuribenzoic Acid results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human p-chloromercuribenzoic acid multiple interactions EXP 6480464 [NOG protein co-treated with p-Chloromercuribenzoic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human p-menthan-3-ol decreases expression EXP 6480464 Menthol results in decreased expression of BAG2 mRNA CTD PMID:26760959 BAG2 Human panobinostat multiple interactions EXP 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human panobinostat increases expression EXP 6480464 panobinostat results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human paracetamol affects expression ISO Bag2 (Mus musculus) 6480464 Acetaminophen affects the expression of BAG2 mRNA CTD PMID:17562736 BAG2 Human paracetamol decreases expression ISO Bag2 (Rattus norvegicus) 6480464 Acetaminophen results in decreased expression of BAG2 mRNA CTD PMID:33387578 BAG2 Human paraquat increases expression ISO Bag2 (Rattus norvegicus) 6480464 Paraquat results in increased expression of BAG2 mRNA CTD PMID:32680482 BAG2 Human perfluorooctanoic acid increases expression EXP 6480464 perfluorooctanoic acid results in increased expression of BAG2 protein CTD PMID:26879310 BAG2 Human phenylmercury acetate increases expression EXP 6480464 Phenylmercuric Acetate results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human phenylmercury acetate multiple interactions EXP 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human pinosylvin decreases expression EXP 6480464 pinosylvin results in decreased expression of BAG2 mRNA CTD PMID:23333577 BAG2 Human pirinixic acid multiple interactions ISO Bag2 (Mus musculus) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of BAG2 mRNA and [pirinixic acid co-treated with PPARA] results in increased expression of BAG2 mRNA CTD PMID:19710929 and PMID:20813756 BAG2 Human pirinixic acid increases expression ISO Bag2 (Mus musculus) 6480464 pirinixic acid results in increased expression of BAG2 mRNA CTD PMID:18301758 and PMID:20813756 BAG2 Human potassium chromate decreases expression EXP 6480464 potassium chromate(VI) results in decreased expression of BAG2 mRNA CTD PMID:22079256 BAG2 Human potassium chromate multiple interactions EXP 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of BAG2 mRNA CTD PMID:22079256 BAG2 Human quercetin decreases expression EXP 6480464 Quercetin results in decreased expression of BAG2 mRNA CTD PMID:21632981 BAG2 Human resveratrol multiple interactions EXP 6480464 [Coumestrol co-treated with resveratrol] results in increased expression of BAG2 mRNA CTD PMID:19167446 BAG2 Human resveratrol increases expression ISO Bag2 (Mus musculus) 6480464 resveratrol results in increased expression of BAG2 protein CTD PMID:25505154 BAG2 Human SB 431542 multiple interactions EXP 6480464 [NOG protein co-treated with belinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 BAG2 Human sodium arsenite affects methylation EXP 6480464 sodium arsenite affects the methylation of BAG2 gene CTD PMID:28589171 BAG2 Human sodium arsenite multiple interactions EXP 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of BAG2 mRNA and [sodium arsenite results in increased abundance of Arsenic] which results in increased expression of BAG2 mRNA CTD PMID:39836092 BAG2 Human sodium fluoride increases expression ISO Bag2 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of BAG2 protein CTD PMID:28918527 BAG2 Human tetrachloromethane increases expression ISO Bag2 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of BAG2 mRNA CTD PMID:17484886 BAG2 Human tetrachloromethane increases expression ISO Bag2 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of BAG2 mRNA CTD PMID:31150632 BAG2 Human tetrachloromethane multiple interactions ISO Bag2 (Rattus norvegicus) 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of BAG2 mRNA] CTD PMID:31150632 BAG2 Human topotecan multiple interactions ISO Bag2 (Rattus norvegicus) 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of BAG2 mRNA CTD PMID:25729387 BAG2 Human trans-pinosylvin decreases expression EXP 6480464 pinosylvin results in decreased expression of BAG2 mRNA CTD PMID:23333577 BAG2 Human trichostatin A increases expression EXP 6480464 trichostatin A results in increased expression of BAG2 mRNA CTD PMID:24935251 and PMID:26272509 BAG2 Human trichostatin A multiple interactions EXP 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human trimellitic anhydride increases expression ISO Bag2 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of BAG2 mRNA CTD PMID:19042947 BAG2 Human triphenyl phosphate affects expression EXP 6480464 triphenyl phosphate affects the expression of BAG2 mRNA CTD PMID:37042841 BAG2 Human triptonide decreases expression ISO Bag2 (Mus musculus) 6480464 triptonide results in decreased expression of BAG2 mRNA CTD PMID:33045310 BAG2 Human valproic acid decreases methylation EXP 6480464 Valproic Acid results in decreased methylation of BAG2 gene CTD PMID:29154799 BAG2 Human valproic acid multiple interactions EXP 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human valproic acid increases expression EXP 6480464 Valproic Acid results in increased expression of BAG2 mRNA CTD PMID:23179753 more ... BAG2 Human valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of BAG2 mRNA CTD PMID:25979313 BAG2 Human valproic acid affects expression ISO Bag2 (Mus musculus) 6480464 Valproic Acid affects the expression of BAG2 mRNA CTD PMID:17292431 BAG2 Human valproic acid decreases expression ISO Bag2 (Mus musculus) 6480464 Valproic Acid results in decreased expression of BAG2 mRNA CTD PMID:21427059 BAG2 Human vancomycin decreases expression ISO Bag2 (Mus musculus) 6480464 Vancomycin results in decreased expression of BAG2 mRNA CTD PMID:18930951 BAG2 Human vinclozolin affects expression ISO Bag2 (Rattus norvegicus) 6480464 vinclozolin affects the expression of BAG2 mRNA CTD PMID:19015723 BAG2 Human vinclozolin decreases methylation ISO Bag2 (Rattus norvegicus) 6480464 vinclozolin results in decreased methylation of BAG2 gene CTD PMID:31079544 BAG2 Human vorinostat multiple interactions EXP 6480464 [NOG protein co-treated with Vorinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of BAG2 mRNA CTD PMID:27188386 BAG2 Human vorinostat increases expression EXP 6480464 vorinostat results in increased expression of BAG2 mRNA CTD PMID:26272509 BAG2 Human zinc atom multiple interactions EXP 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of BAG2 mRNA CTD PMID:18593933 BAG2 Human zinc(0) multiple interactions EXP 6480464 [PCI 5002 co-treated with Zinc] results in increased expression of BAG2 mRNA CTD PMID:18593933
Imported Annotations - KEGG (archival)
(+)-schisandrin B (ISO) (-)-epigallocatechin 3-gallate (EXP) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (EXP,ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2-amino-14,16-dimethyloctadecan-3-ol (EXP) 3-chloropropane-1,2-diol (ISO) 3-isobutyl-1-methyl-7H-xanthine (EXP) 4,4'-diaminodiphenylmethane (ISO) 4,4'-sulfonyldiphenol (EXP) 4-\{[(5,5,8,8-tetramethyl-5,6,7,8-tetrahydronaphthalen-2-yl)carbonyl]amino\}benzoic acid (EXP) 4-hydroxyphenyl retinamide (ISO) 5-aza-2'-deoxycytidine (EXP) acetamide (ISO) acrylamide (EXP) aflatoxin B1 (EXP,ISO) all-trans-retinoic acid (EXP) aristolochic acid A (EXP) arsane (EXP) arsenic atom (EXP) arsenite(3-) (EXP) atrazine (ISO) belinostat (EXP) benzo[a]pyrene (EXP,ISO) benzo[a]pyrene diol epoxide I (EXP) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol AF (EXP) Bisphenol B (EXP) bisphenol F (EXP) cadmium atom (EXP,ISO) cadmium dichloride (ISO) calcitriol (EXP) carbamazepine (EXP) CCCP (EXP) chlordecone (ISO) chromium(6+) (ISO) cobalt dichloride (ISO) coumestrol (EXP) Cuprizon (ISO) cyclosporin A (EXP) DDE (EXP) dexamethasone (EXP) Dibutyl phosphate (EXP) dibutyl phthalate (ISO) dichloroacetic acid (ISO) dioxygen (EXP) diquat (ISO) dorsomorphin (EXP) doxorubicin (EXP,ISO) entinostat (EXP) enzyme inhibitor (EXP) ethyl methanesulfonate (EXP) etoposide (EXP) folic acid (ISO) FR900359 (EXP) gentamycin (ISO) hydrogen peroxide (EXP) indometacin (EXP) ivermectin (EXP) leflunomide (EXP) manganese atom (EXP) manganese(0) (EXP) manganese(II) chloride (EXP) mercury dibromide (EXP) mercury dichloride (ISO) methyl methanesulfonate (EXP) methylmercury chloride (EXP) methylparaben (EXP) N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal (EXP) oxaliplatin (ISO) p-chloromercuribenzoic acid (EXP) p-menthan-3-ol (EXP) panobinostat (EXP) paracetamol (ISO) paraquat (ISO) perfluorooctanoic acid (EXP) phenylmercury acetate (EXP) pinosylvin (EXP) pirinixic acid (ISO) potassium chromate (EXP) quercetin (EXP) resveratrol (EXP,ISO) SB 431542 (EXP) sodium arsenite (EXP) sodium fluoride (ISO) tetrachloromethane (ISO) topotecan (ISO) trans-pinosylvin (EXP) trichostatin A (EXP) trimellitic anhydride (ISO) triphenyl phosphate (EXP) triptonide (ISO) valproic acid (EXP,ISO) vancomycin (ISO) vinclozolin (ISO) vorinostat (EXP) zinc atom (EXP) zinc(0) (EXP)
BAG2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 57,172,326 - 57,189,833 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 57,172,326 - 57,189,833 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 57,037,124 - 57,054,631 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 57,145,293 - 57,157,694 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 57,145,292 - 57,157,692 NCBI Celera 6 58,700,203 - 58,713,112 (+) NCBI Celera Cytogenetic Map 6 p12.1 NCBI HuRef 6 56,871,161 - 56,884,070 (+) NCBI HuRef CHM1_1 6 57,037,430 - 57,050,339 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 57,011,351 - 57,028,858 (+) NCBI T2T-CHM13v2.0
Bag2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 33,784,565 - 33,796,831 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 33,784,565 - 33,796,876 (-) Ensembl GRCm39 Ensembl GRCm38 1 33,745,484 - 33,757,750 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 33,745,484 - 33,757,795 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 33,802,329 - 33,814,595 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 33,690,030 - 33,702,309 (-) NCBI MGSCv36 mm8 Celera 1 33,520,517 - 33,532,756 (-) NCBI Celera Cytogenetic Map 1 B NCBI cM Map 1 12.81 NCBI
Bag2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 9 43,465,993 - 43,476,637 (-) NCBI GRCr8 mRatBN7.2 9 35,970,033 - 35,980,677 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 9 35,970,033 - 35,980,721 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 9 44,466,951 - 44,477,595 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 9 49,598,137 - 49,608,781 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 9 47,880,055 - 47,890,699 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 9 38,456,487 - 38,467,120 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 9 38,456,468 - 38,467,118 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 9 38,145,393 - 38,147,904 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 9 32,491,167 - 32,493,678 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 Celera 9 33,762,835 - 33,773,286 (-) NCBI Celera Cytogenetic Map 9 q21 NCBI
Bag2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955502 2,984,233 - 2,994,457 (-) NCBI ChiLan1.0 ChiLan1.0
BAG2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 71,642,366 - 71,656,326 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 67,523,808 - 67,536,531 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 56,730,297 - 56,743,123 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 58,360,889 - 58,373,733 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 58,360,889 - 58,373,733 (+) Ensembl panpan1.1 panPan2
BAG2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 24,353,549 - 24,369,190 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 24,353,663 - 24,368,350 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 24,283,590 - 24,299,229 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 24,893,036 - 24,908,696 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 24,893,052 - 24,908,693 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 24,390,264 - 24,405,914 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 24,491,610 - 24,506,382 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 24,623,002 - 24,638,655 (+) NCBI UU_Cfam_GSD_1.0
Bag2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 59,817,850 - 59,829,590 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936476 4,129,013 - 4,142,357 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936476 4,131,159 - 4,142,357 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
BAG2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 28,659,753 - 28,680,491 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 28,668,587 - 28,680,497 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 33,129,078 - 33,140,950 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
BAG2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 17 14,420,196 - 14,432,910 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 17 14,420,947 - 14,433,354 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666058 20,509,961 - 20,527,469 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Bag2
.
Predicted Target Of
Count of predictions: 1821 Count of miRNA genes: 794 Interacting mature miRNAs: 911 Transcripts: ENST00000370693, ENST00000545080 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
RH46599
Human Assembly Chr Position (strand) Source JBrowse GRCh37 6 57,049,468 - 57,049,648 UniSTS GRCh37 Build 36 6 57,157,427 - 57,157,607 RGD NCBI36 Celera 6 58,712,567 - 58,712,747 RGD Cytogenetic Map 6 p12.1-p11.2 UniSTS HuRef 6 56,883,525 - 56,883,705 UniSTS
AL035194
Human Assembly Chr Position (strand) Source JBrowse GRCh37 6 57,046,833 - 57,046,981 UniSTS GRCh37 Build 36 6 57,154,792 - 57,154,940 RGD NCBI36 Celera 6 58,709,932 - 58,710,080 RGD Cytogenetic Map 6 p12.1-p11.2 UniSTS HuRef 6 56,880,890 - 56,881,038 UniSTS
SHGC-34200
Human Assembly Chr Position (strand) Source JBrowse GRCh37 6 57,049,224 - 57,049,361 UniSTS GRCh37 Build 36 6 57,157,183 - 57,157,320 RGD NCBI36 Celera 6 58,712,323 - 58,712,460 RGD Cytogenetic Map 6 p12.1-p11.2 UniSTS HuRef 6 56,883,281 - 56,883,418 UniSTS TNG Radiation Hybrid Map 6 28265.0 UniSTS GeneMap99-GB4 RH Map 6 221.18 UniSTS Whitehead-RH Map 6 306.3 UniSTS NCBI RH Map 6 722.7 UniSTS
BAG2_7951
Human Assembly Chr Position (strand) Source JBrowse GRCh37 6 57,048,583 - 57,049,505 UniSTS GRCh37 Build 36 6 57,156,542 - 57,157,464 RGD NCBI36 Celera 6 58,711,682 - 58,712,604 RGD HuRef 6 56,882,640 - 56,883,562 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
entire extraembryonic component
1204
2436
2788
2251
4955
1724
2348
5
622
1950
465
2268
7299
6468
53
3718
850
1743
1614
172
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENST00000370693 ⟹ ENSP00000359727
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38.p14 Ensembl 6 57,172,326 - 57,189,833 (+) Ensembl
RefSeq Acc Id:
NM_004282 ⟹ NP_004273
RefSeq Status:
REVIEWED
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 6 57,172,326 - 57,189,833 (+) NCBI GRCh37 6 57,037,104 - 57,050,013 (+) RGD GRCh37 6 57,037,104 - 57,050,013 (+) NCBI Build 36 6 57,145,293 - 57,157,694 (+) NCBI Archive Celera 6 58,700,203 - 58,713,112 (+) RGD HuRef 6 56,871,161 - 56,884,070 (+) ENTREZGENE CHM1_1 6 57,037,430 - 57,050,339 (+) NCBI T2T-CHM13v2.0 6 57,011,351 - 57,028,858 (+) NCBI
Sequence:
AGACGATCCGCTAGCCACATTAGGCGCTCGGTCTCTGCGTCCGCCCCTCCCGTGCCTCAGAGACTTGCGCTCCCCAGGCCCGAGCCCCTGTCGGCCCATCCTCGAGCCCGTGTGGCTCGCGAACCTCT
hide sequence
RefSeq Acc Id:
XM_005249490 ⟹ XP_005249547
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 6 57,172,870 - 57,189,833 (+) NCBI
Sequence:
GAGGCCGCGTGTGGCGGGCCGGGGCCTGGGGCACAGTGAGGCTGCGGCAACCGAAGTTGCTTGTTGAGATTTGTTGTGGATGGACGTGGTGTAGTTTTGTTTGTTTCTTGGATTATCTCCCCTAGTCC
hide sequence
RefSeq Acc Id:
XM_011514999 ⟹ XP_011513301
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source GRCh38 6 57,172,870 - 57,189,833 (+) NCBI
Sequence:
GAGGCCGCGTGTGGCGGGCCGGGGCCTGGGGCACAGTGAGGCTGCGGCAACCGAAGTTGCTTGTTGAGATTTGTTGTGGATGGACGTGGTGTAGTTTTGTTTGTTTCTTGGATTATCTCCCCTAGTCC
hide sequence
RefSeq Acc Id:
XM_054356854 ⟹ XP_054212829
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source T2T-CHM13v2.0 6 57,011,895 - 57,028,858 (+) NCBI
RefSeq Acc Id:
XM_054356855 ⟹ XP_054212830
Type:
CODING
Position:
Human Assembly Chr Position (strand) Source T2T-CHM13v2.0 6 57,011,895 - 57,028,858 (+) NCBI
RefSeq Acc Id:
NP_004273 ⟸ NM_004282
- UniProtKB:
Q08AS9 (UniProtKB/Swiss-Prot), B4DXE2 (UniProtKB/Swiss-Prot), Q6FID0 (UniProtKB/Swiss-Prot), O95816 (UniProtKB/Swiss-Prot), B3KM36 (UniProtKB/TrEMBL), B3KN59 (UniProtKB/TrEMBL)
- Sequence:
MAQAKINAKANEGRFCRSSSMADRSSRLLESLDQLELRVEALREAATAVEQEKEILLEMIHSIQNSQDMRQISDGEREELNLTANRLMGRTLTVEVSVETIRNPQQQESLKHATRIIDEVVNKFLDDL
hide sequence
RefSeq Acc Id:
XP_005249547 ⟸ XM_005249490
- Peptide Label:
isoform X1
- UniProtKB:
B3KM36 (UniProtKB/TrEMBL), B3KN59 (UniProtKB/TrEMBL)
- Sequence:
MPHMWVEALREAATAVEQEKEILLEMIHSIQNSQDMRQISDGEREELNLTANRLMGRTLTVEVSVETIRNPQQQESLKHATRIIDEVVNKFLDDLGNAKSHLMSLYSACSSEVPHGPVDQKFQSIVIG
hide sequence
RefSeq Acc Id:
XP_011513301 ⟸ XM_011514999
- Peptide Label:
isoform X1
- UniProtKB:
B3KM36 (UniProtKB/TrEMBL), B3KN59 (UniProtKB/TrEMBL)
- Sequence:
MPHMWVEALREAATAVEQEKEILLEMIHSIQNSQDMRQISDGEREELNLTANRLMGRTLTVEVS
hide sequence
Ensembl Acc Id:
ENSP00000359727 ⟸ ENST00000370693
RefSeq Acc Id:
XP_054212829 ⟸ XM_054356854
- Peptide Label:
isoform X1
- UniProtKB:
B3KM36 (UniProtKB/TrEMBL), B3KN59 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_054212830 ⟸ XM_054356855
- Peptide Label:
isoform X1
- UniProtKB:
B3KM36 (UniProtKB/TrEMBL), B3KN59 (UniProtKB/TrEMBL)
RGD ID: 6803779 Promoter ID: HG_KWN:53942 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: CD4+TCell, CD4+TCell_12Hour, HeLa_S3, Jurkat, K562, Lymphoblastoid, NB4 Transcripts: NM_004282, OTTHUMT00000041045 Position: Human Assembly Chr Position (strand) Source Build 36 6 57,145,061 - 57,145,561 (+) MPROMDB
RGD ID: 6814758 Promoter ID: HG_XEF:6900 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: K562 Transcripts: NM_001006728 Position: Human Assembly Chr Position (strand) Source Build 36 6 57,155,916 - 57,156,416 (+) MPROMDB
RGD ID: 7208401 Promoter ID: EPDNEW_H9947 Type: initiation region Name: BAG2_3 Description: BCL2 associated athanogene 2 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_H9948 EPDNEW_H9949 Experiment Methods: Single-end sequencing.; Paired-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 6 57,170,088 - 57,170,148 EPDNEW
RGD ID: 7208405 Promoter ID: EPDNEW_H9948 Type: initiation region Name: BAG2_1 Description: BCL2 associated athanogene 2 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_H9947 EPDNEW_H9949 Experiment Methods: Single-end sequencing.; Paired-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 6 57,172,326 - 57,172,386 EPDNEW
RGD ID: 7208407 Promoter ID: EPDNEW_H9949 Type: initiation region Name: BAG2_2 Description: BCL2 associated athanogene 2 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Alternative Promoters: null; see alsoEPDNEW_H9947 EPDNEW_H9948 Experiment Methods: Single-end sequencing. Position: Human Assembly Chr Position (strand) Source GRCh38 6 57,172,641 - 57,172,701 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-10-08
BAG2
BAG cochaperone 2
BAG2
BCL2 associated athanogene 2
Symbol and/or name change
5135510 APPROVED
2015-11-24
BAG2
BCL2 associated athanogene 2
BAG2
BCL2-associated athanogene 2
Symbol and/or name change
5135510 APPROVED
