Symbol:
Krt7
Name:
keratin 7
RGD ID:
1322015
MGI Page
MGI
Description:
Predicted to be a structural constituent of skin epidermis. Predicted to be involved in intermediate filament organization and keratinization. Predicted to be located in cytosol and intermediate filament cytoskeleton. Predicted to be active in keratin filament. Is expressed in several structures, including alimentary system; genitourinary system; sensory organ; skin; and trophectoderm. Orthologous to human KRT7 (keratin 7).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
CK-7; Cytokeratin 7; cytokeratin-7; D15Wsu77; D15Wsu77e; K7; keratin complex 2, basic, gene 7; keratin, type II cytoskeletal 7; keratin-7; Krt2-; Krt2-7; MGC11625; sarcolectin; type-II keratin Kb7
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
KRT7 (keratin 7) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoMCL, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Krt7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Krt7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
KRT7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
KRT7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Krt7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
KRT7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
KRT7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Krt7 (keratin 7) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Krt7 (keratin 7)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
KRT7 (keratin 7)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
krt5 (keratin 5)
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER)
Danio rerio (zebrafish):
krt4 (keratin 4)
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER)
Danio rerio (zebrafish):
zgc:158846
Alliance
DIOPT (Ensembl Compara|OrthoFinder|PANTHER)
Caenorhabditis elegans (roundworm):
ifc-1
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA)
Caenorhabditis elegans (roundworm):
ifd-2
Alliance
DIOPT (Ensembl Compara|InParanoid|OMA)
Xenopus tropicalis (tropical clawed frog):
krt7
Alliance
DIOPT (Hieranoid|OMA|OrthoFinder|OrthoInspector|PhylomeDB)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 101,310,284 - 101,325,687 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 101,308,924 - 101,328,194 (+) Ensembl GRCm39 Ensembl GRCm38 15 101,412,403 - 101,427,806 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 101,411,043 - 101,430,313 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 101,242,834 - 101,258,237 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 101,240,437 - 101,255,827 (+) NCBI MGSCv36 mm8 Celera 15 103,560,951 - 103,576,262 (+) NCBI Celera Cytogenetic Map 15 F1- F2 NCBI cM Map 15 56.88 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Krt7 Mouse (-)-demecolcine increases expression ISO KRT7 (Homo sapiens) 6480464 Demecolcine results in increased expression of KRT7 mRNA CTD PMID:23649840 Krt7 Mouse 1,1-dichloroethene decreases expression EXP 6480464 vinylidene chloride results in decreased expression of KRT7 mRNA CTD PMID:26682919 Krt7 Mouse 1,2-dimethylhydrazine multiple interactions EXP 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in increased expression of KRT7 mRNA] CTD PMID:22206623 Krt7 Mouse 1,2-dimethylhydrazine increases expression EXP 6480464 1 and 2-Dimethylhydrazine results in increased expression of KRT7 mRNA CTD PMID:22206623 Krt7 Mouse 1-naphthyl isothiocyanate increases expression ISO Krt7 (Rattus norvegicus) 6480464 1-Naphthylisothiocyanate results in increased expression of KRT7 mRNA CTD PMID:30723492 Krt7 Mouse 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of KRT7 mRNA CTD PMID:17942748 Krt7 Mouse 17alpha-ethynylestradiol increases expression ISO Krt7 (Rattus norvegicus) 6480464 Ethinyl Estradiol results in increased expression of KRT7 mRNA CTD PMID:17557909 Krt7 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of KRT7 mRNA CTD PMID:17942748 Krt7 Mouse 17alpha-ethynylestradiol affects expression EXP 6480464 Ethinyl Estradiol affects the expression of KRT7 mRNA CTD PMID:17555576 Krt7 Mouse 17beta-estradiol increases expression ISO KRT7 (Homo sapiens) 6480464 Estradiol results in increased expression of KRT7 mRNA CTD PMID:19484750 Krt7 Mouse 17beta-estradiol multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of KRT7 mRNA CTD PMID:32741896 Krt7 Mouse 17beta-estradiol multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Estradiol co-treated with TGFB1 protein] results in increased expression of KRT7 mRNA CTD PMID:30165855 Krt7 Mouse 17beta-estradiol multiple interactions EXP 6480464 [bisphenol A results in increased susceptibility to Estradiol] which results in decreased expression of KRT7 mRNA CTD PMID:27312807 Krt7 Mouse 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of KRT7 mRNA CTD PMID:19484750 Krt7 Mouse 17beta-estradiol 3-benzoate multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of KRT7 mRNA CTD PMID:32741896 Krt7 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of KRT7 mRNA CTD PMID:17942748 Krt7 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Krt7 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of KRT7 mRNA CTD PMID:32109520 more ... Krt7 Mouse 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO KRT7 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of KRT7 protein CTD PMID:21410761 Krt7 Mouse 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of KRT7 mRNA CTD PMID:21570461 Krt7 Mouse 2,4-diaminotoluene increases expression EXP 6480464 2 and 4-diaminotoluene results in increased expression of KRT7 mRNA CTD PMID:20713471 Krt7 Mouse 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression EXP 6480464 2 more ... CTD PMID:38648751 Krt7 Mouse 2,6-dimethoxyphenol multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Krt7 Mouse 2-hydroxypropanoic acid decreases expression ISO KRT7 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of KRT7 mRNA CTD PMID:30851411 Krt7 Mouse 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Puromycin Aminonucleoside results in decreased expression of KRT7 mRNA and Puromycin Aminonucleoside results in decreased expression of KRT7 protein CTD PMID:19617259 Krt7 Mouse 3-Nitrobenzanthrone affects expression ISO KRT7 (Homo sapiens) 6480464 3-nitrobenzanthrone affects the expression of KRT7 mRNA CTD PMID:34036453 Krt7 Mouse 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of KRT7 mRNA CTD PMID:18648102 Krt7 Mouse 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol S co-treated with Tretinoin] results in decreased expression of KRT7 mRNA CTD PMID:30951980 Krt7 Mouse 4,4'-sulfonyldiphenol affects methylation EXP 6480464 bisphenol S affects the methylation of KRT7 gene CTD PMID:31683443 Krt7 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of KRT7 mRNA CTD PMID:30951980 Krt7 Mouse 4-hydroxyphenyl retinamide decreases expression EXP 6480464 Fenretinide results in decreased expression of KRT7 mRNA CTD PMID:28973697 Krt7 Mouse 6-propyl-2-thiouracil increases expression ISO Krt7 (Rattus norvegicus) 6480464 Propylthiouracil results in increased expression of KRT7 mRNA CTD PMID:24780913 Krt7 Mouse 6-propyl-2-thiouracil decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Propylthiouracil results in decreased expression of KRT7 mRNA CTD PMID:30047161 Krt7 Mouse 8'-apo-beta,psi-caroten-8'-al affects expression ISO KRT7 (Homo sapiens) 6480464 apocarotenal affects the expression of KRT7 mRNA CTD PMID:17034753 Krt7 Mouse 9-cis-retinoic acid increases expression ISO KRT7 (Homo sapiens) 6480464 Alitretinoin results in increased expression of KRT7 mRNA and Alitretinoin results in increased expression of KRT7 protein CTD PMID:15982314 and PMID:17034753 Krt7 Mouse acrolein increases metabolic processing ISO KRT7 (Homo sapiens) 6480464 Acrolein results in increased metabolism of KRT7 protein CTD PMID:20015449 Krt7 Mouse acrolein multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of KRT7 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of KRT7 mRNA CTD PMID:32699268 Krt7 Mouse actinomycin D multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of KRT7 protein CTD PMID:38460933 Krt7 Mouse all-trans-4-oxoretinoic acid increases expression ISO KRT7 (Homo sapiens) 6480464 4-oxoretinoic acid results in increased expression of KRT7 mRNA and 4-oxoretinoic acid results in increased expression of KRT7 protein CTD PMID:15982314 and PMID:17034753 Krt7 Mouse all-trans-4-oxoretinol increases expression ISO KRT7 (Homo sapiens) 6480464 4-oxoretinol results in increased expression of KRT7 mRNA CTD PMID:17034753 Krt7 Mouse all-trans-retinoic acid increases expression ISO KRT7 (Homo sapiens) 6480464 Tretinoin metabolite results in increased expression of KRT7 mRNA more ... CTD PMID:15982314 more ... Krt7 Mouse all-trans-retinoic acid multiple interactions EXP 6480464 [bisphenol F co-treated with Tretinoin] results in decreased expression of KRT7 mRNA and [bisphenol S co-treated with Tretinoin] results in decreased expression of KRT7 mRNA CTD PMID:30951980 Krt7 Mouse all-trans-retinol increases expression ISO KRT7 (Homo sapiens) 6480464 Vitamin A results in increased expression of KRT7 mRNA CTD PMID:17034753 Krt7 Mouse alpha-pinene multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of KRT7 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of KRT7 mRNA CTD PMID:32699268 Krt7 Mouse amitrole decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Amitrole results in decreased expression of KRT7 mRNA CTD PMID:30047161 Krt7 Mouse ammonium chloride increases expression ISO Krt7 (Rattus norvegicus) 6480464 Ammonium Chloride results in increased expression of KRT7 protein CTD PMID:16483693 Krt7 Mouse aristolochic acid A increases expression ISO KRT7 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of KRT7 mRNA CTD PMID:33212167 Krt7 Mouse arsenite(3-) decreases expression ISO KRT7 (Homo sapiens) 6480464 arsenite results in decreased expression of KRT7 mRNA CTD PMID:19716837 Krt7 Mouse arsenite(3-) increases methylation ISO KRT7 (Homo sapiens) 6480464 arsenite results in increased methylation of KRT7 promoter CTD PMID:19716837 Krt7 Mouse arsenous acid decreases expression ISO KRT7 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of KRT7 protein CTD PMID:25419056 Krt7 Mouse atrazine decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Atrazine results in decreased expression of KRT7 mRNA CTD PMID:36841081 Krt7 Mouse benzo[a]pyrene multiple interactions EXP 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to KRT7 promoter] CTD PMID:19654925 Krt7 Mouse benzo[a]pyrene affects methylation ISO KRT7 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of KRT7 5' UTR CTD PMID:27901495 Krt7 Mouse benzo[a]pyrene decreases methylation ISO KRT7 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of KRT7 exon and Benzo(a)pyrene results in decreased methylation of KRT7 promoter CTD PMID:27901495 Krt7 Mouse benzo[a]pyrene multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Soot co-treated with Benzo(a)pyrene] results in increased expression of KRT7 protein modified form CTD PMID:24464499 Krt7 Mouse benzo[a]pyrene diol epoxide I increases expression ISO KRT7 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Krt7 Mouse beta-carotene affects expression ISO KRT7 (Homo sapiens) 6480464 beta Carotene affects the expression of KRT7 mRNA CTD PMID:17034753 Krt7 Mouse beta-lapachone decreases expression ISO KRT7 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of KRT7 mRNA CTD PMID:38218311 Krt7 Mouse bisphenol A decreases expression ISO Krt7 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of KRT7 mRNA CTD PMID:25181051 more ... Krt7 Mouse bisphenol A increases expression ISO KRT7 (Homo sapiens) 6480464 bisphenol A results in increased expression of KRT7 protein CTD PMID:34186270 Krt7 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of KRT7 mRNA CTD PMID:30951980 and PMID:32156529 Krt7 Mouse bisphenol A multiple interactions EXP 6480464 [bisphenol A results in increased susceptibility to Estradiol] which results in decreased expression of KRT7 mRNA CTD PMID:27312807 Krt7 Mouse bisphenol A decreases methylation EXP 6480464 bisphenol A results in decreased methylation of KRT7 promoter CTD PMID:27312807 Krt7 Mouse bisphenol A decreases expression ISO KRT7 (Homo sapiens) 6480464 bisphenol A results in decreased expression of KRT7 mRNA CTD PMID:25047013 and PMID:27685785 Krt7 Mouse bisphenol AF increases expression ISO KRT7 (Homo sapiens) 6480464 bisphenol AF results in increased expression of KRT7 protein CTD PMID:34186270 Krt7 Mouse Bisphenol B increases expression ISO KRT7 (Homo sapiens) 6480464 bisphenol B results in increased expression of KRT7 protein CTD PMID:34186270 Krt7 Mouse bisphenol F increases expression EXP 6480464 bisphenol F results in increased expression of KRT7 mRNA CTD PMID:30951980 Krt7 Mouse bisphenol F increases expression ISO KRT7 (Homo sapiens) 6480464 bisphenol F results in increased expression of KRT7 protein CTD PMID:34186270 Krt7 Mouse bisphenol F multiple interactions EXP 6480464 [bisphenol F co-treated with Tretinoin] results in decreased expression of KRT7 mRNA CTD PMID:30951980 Krt7 Mouse Butylbenzyl phthalate decreases expression ISO KRT7 (Homo sapiens) 6480464 butylbenzyl phthalate results in decreased expression of KRT7 protein CTD PMID:22552774 Krt7 Mouse Butylbenzyl phthalate multiple interactions ISO KRT7 (Homo sapiens) 6480464 HDAC6 mutant form inhibits the reaction [butylbenzyl phthalate results in decreased expression of KRT7 protein] CTD PMID:22552774 Krt7 Mouse cadmium atom decreases expression ISO KRT7 (Homo sapiens) 6480464 Cadmium results in decreased expression of KRT7 mRNA CTD PMID:19716837 Krt7 Mouse cadmium atom multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of KRT7 protein and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KRT7 mRNA CTD PMID:33040242 and PMID:36602393 Krt7 Mouse cadmium atom increases methylation ISO KRT7 (Homo sapiens) 6480464 Cadmium results in increased methylation of KRT7 promoter CTD PMID:19716837 Krt7 Mouse cadmium dichloride multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of KRT7 protein and [Cadmium Chloride results in increased abundance of Cadmium] which results in increased expression of KRT7 mRNA CTD PMID:33040242 and PMID:36602393 Krt7 Mouse calcitriol increases expression ISO KRT7 (Homo sapiens) 6480464 Calcitriol results in increased expression of KRT7 mRNA CTD PMID:26485663 Krt7 Mouse cannabidiol increases expression ISO KRT7 (Homo sapiens) 6480464 Cannabidiol results in increased expression of KRT7 mRNA CTD PMID:27918106 Krt7 Mouse captan decreases expression EXP 6480464 Captan results in decreased expression of KRT7 mRNA CTD PMID:31558096 Krt7 Mouse carbon nanotube decreases expression ISO KRT7 (Homo sapiens) 6480464 Nanotubes and Carbon results in decreased expression of KRT7 mRNA CTD PMID:24389112 Krt7 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes more ... CTD PMID:25554681 Krt7 Mouse chlordecone increases expression EXP 6480464 Chlordecone results in increased expression of KRT7 mRNA CTD PMID:33711761 Krt7 Mouse chloropicrin decreases expression ISO KRT7 (Homo sapiens) 6480464 chloropicrin results in decreased expression of KRT7 mRNA CTD PMID:26352163 and PMID:28476498 Krt7 Mouse chromium(6+) affects expression EXP 6480464 chromium hexavalent ion affects the expression of KRT7 mRNA CTD PMID:28472532 Krt7 Mouse cisplatin decreases expression ISO KRT7 (Homo sapiens) 6480464 Cisplatin results in decreased expression of KRT7 mRNA CTD PMID:27392435 Krt7 Mouse cisplatin multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in decreased expression of KRT7 mRNA CTD PMID:27392435 Krt7 Mouse cobalt dichloride decreases expression ISO KRT7 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of KRT7 mRNA CTD PMID:19320972 and PMID:19376846 Krt7 Mouse copper atom multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of KRT7 mRNA CTD PMID:20971185 Krt7 Mouse copper atom multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression of KRT7 mRNA CTD PMID:15467011 Krt7 Mouse copper(0) multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NSC 689534 binds to Copper] which results in increased expression of KRT7 mRNA CTD PMID:20971185 Krt7 Mouse copper(0) multiple interactions EXP 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression of KRT7 mRNA CTD PMID:15467011 Krt7 Mouse crocidolite asbestos decreases expression ISO KRT7 (Homo sapiens) 6480464 Asbestos and Crocidolite results in decreased expression of KRT7 mRNA CTD PMID:28056339 Krt7 Mouse Cuprizon increases expression ISO Krt7 (Rattus norvegicus) 6480464 Cuprizone results in increased expression of KRT7 mRNA CTD PMID:26577399 Krt7 Mouse cyclosporin A decreases expression ISO KRT7 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of KRT7 mRNA CTD PMID:27989131 Krt7 Mouse diarsenic trioxide decreases expression ISO KRT7 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of KRT7 protein CTD PMID:25419056 Krt7 Mouse dibutyl phthalate increases expression ISO Krt7 (Rattus norvegicus) 6480464 Dibutyl Phthalate results in increased expression of KRT7 mRNA CTD PMID:21266533 and PMID:24893172 Krt7 Mouse dibutyl phthalate decreases expression ISO KRT7 (Homo sapiens) 6480464 Dibutyl Phthalate results in decreased expression of KRT7 protein CTD PMID:22552774 Krt7 Mouse dibutyl phthalate multiple interactions ISO KRT7 (Homo sapiens) 6480464 HDAC6 mutant form inhibits the reaction [Dibutyl Phthalate results in decreased expression of KRT7 protein] CTD PMID:22552774 Krt7 Mouse dimethylselenide multiple interactions ISO KRT7 (Homo sapiens) 6480464 [[Hydroxyl Radical results in increased oxidation of dimethylselenide] which results in decreased expression of KRT7-AS mRNA] which results in decreased expression of KRT7 mRNA and [[Ozone results in increased oxidation of dimethylselenide] which results in decreased expression of KRT7-AS mRNA] which results in decreased expression of KRT7 mRNA CTD PMID:33656867 Krt7 Mouse dioxygen multiple interactions EXP 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of KRT7 mRNA CTD PMID:30529165 Krt7 Mouse dioxygen multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in increased expression of KRT7 mRNA CTD PMID:33729688 Krt7 Mouse dorsomorphin multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Krt7 Mouse elemental selenium increases expression ISO KRT7 (Homo sapiens) 6480464 Selenium results in increased expression of KRT7 mRNA CTD PMID:19244175 Krt7 Mouse endosulfan increases expression ISO Krt7 (Rattus norvegicus) 6480464 Endosulfan results in increased expression of KRT7 mRNA CTD PMID:29391264 Krt7 Mouse entinostat increases expression ISO KRT7 (Homo sapiens) 6480464 entinostat results in increased expression of KRT7 mRNA CTD PMID:26272509 and PMID:27188386 Krt7 Mouse entinostat multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of KRT7 mRNA CTD PMID:27188386 Krt7 Mouse folic acid multiple interactions EXP 6480464 Folic Acid inhibits the reaction [1 and 2-Dimethylhydrazine results in increased expression of KRT7 mRNA] CTD PMID:22206623 Krt7 Mouse folpet decreases expression EXP 6480464 folpet results in decreased expression of KRT7 mRNA CTD PMID:31558096 Krt7 Mouse formaldehyde increases expression ISO KRT7 (Homo sapiens) 6480464 Formaldehyde results in increased expression of KRT7 mRNA CTD PMID:23649840 Krt7 Mouse furan increases expression ISO Krt7 (Rattus norvegicus) 6480464 furan results in increased expression of KRT7 mRNA CTD PMID:27387713 Krt7 Mouse furfural multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Furaldehyde co-treated with pyrogallol 1 more ... CTD PMID:38598786 Krt7 Mouse gentamycin decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Gentamicins results in decreased expression of KRT7 mRNA CTD PMID:22061828 and PMID:33387578 Krt7 Mouse glyphosate increases expression EXP 6480464 Glyphosate results in increased expression of KRT7 protein CTD PMID:37208198 Krt7 Mouse hydroxyl multiple interactions ISO KRT7 (Homo sapiens) 6480464 [[Hydroxyl Radical results in increased oxidation of dimethylselenide] which results in decreased expression of KRT7-AS mRNA] which results in decreased expression of KRT7 mRNA CTD PMID:33656867 Krt7 Mouse inulin multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of KRT7 mRNA CTD PMID:36331819 Krt7 Mouse isotretinoin increases expression ISO KRT7 (Homo sapiens) 6480464 Isotretinoin results in increased expression of KRT7 mRNA and Isotretinoin results in increased expression of KRT7 protein CTD PMID:15982314 Krt7 Mouse kojic acid increases expression ISO KRT7 (Homo sapiens) 6480464 kojic acid results in increased expression of KRT7 mRNA CTD PMID:16595896 Krt7 Mouse lamivudine multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Zidovudine co-treated with Lamivudine] results in increased expression of KRT7 mRNA CTD PMID:15784690 Krt7 Mouse manganese(II) chloride increases expression ISO Krt7 (Rattus norvegicus) 6480464 manganese chloride results in increased expression of KRT7 mRNA CTD PMID:28801915 Krt7 Mouse methamphetamine multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [Methamphetamine co-treated with SCH 23390] results in decreased expression of KRT7 mRNA CTD PMID:19564919 Krt7 Mouse methamphetamine affects expression ISO Krt7 (Rattus norvegicus) 6480464 Methamphetamine affects the expression of KRT7 mRNA CTD PMID:19564919 Krt7 Mouse N-nitrosomorpholine decreases expression ISO Krt7 (Rattus norvegicus) 6480464 N-nitrosomorpholine results in decreased expression of KRT7 protein CTD PMID:19716841 Krt7 Mouse nickel atom decreases expression ISO KRT7 (Homo sapiens) 6480464 Nickel results in decreased expression of KRT7 mRNA CTD PMID:24768652 and PMID:25583101 Krt7 Mouse nickel sulfate affects expression EXP 6480464 nickel sulfate affects the expression of KRT7 mRNA CTD PMID:12718980 Krt7 Mouse Nutlin-3 multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of KRT7 protein CTD PMID:38460933 Krt7 Mouse ozone multiple interactions ISO KRT7 (Homo sapiens) 6480464 [[Ozone results in increased oxidation of dimethylselenide] which results in decreased expression of KRT7-AS mRNA] which results in decreased expression of KRT7 mRNA more ... CTD PMID:32699268 and PMID:33656867 Krt7 Mouse ozone multiple interactions EXP 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of KRT7 mRNA CTD PMID:34911549 Krt7 Mouse paclitaxel increases response to substance ISO KRT7 (Homo sapiens) 6480464 KRT7 protein results in increased susceptibility to Paclitaxel CTD PMID:16734730 Krt7 Mouse paracetamol decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Acetaminophen results in decreased expression of KRT7 mRNA CTD PMID:33387578 Krt7 Mouse perfluorobutyric acid increases expression ISO KRT7 (Homo sapiens) 6480464 perfluorobutyric acid results in increased expression of KRT7 mRNA CTD PMID:36251517 Krt7 Mouse perfluorooctane-1-sulfonic acid increases expression ISO KRT7 (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in increased expression of KRT7 mRNA CTD PMID:27153767 Krt7 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Inulin] results in decreased expression of KRT7 mRNA CTD PMID:36331819 Krt7 Mouse perfluorooctanoic acid increases expression ISO KRT7 (Homo sapiens) 6480464 perfluorooctanoic acid results in increased expression of KRT7 mRNA CTD PMID:36251517 Krt7 Mouse phenylmercury acetate increases expression ISO KRT7 (Homo sapiens) 6480464 Phenylmercuric Acetate results in increased expression of KRT7 mRNA CTD PMID:26272509 Krt7 Mouse phenylmercury acetate multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NOG protein co-treated with Phenylmercuric Acetate co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of KRT7 mRNA CTD PMID:27188386 Krt7 Mouse progesterone increases expression ISO KRT7 (Homo sapiens) 6480464 Progesterone results in increased expression of KRT7 mRNA CTD PMID:18497975 Krt7 Mouse quartz increases expression ISO KRT7 (Homo sapiens) 6480464 Quartz results in increased expression of KRT7 protein CTD PMID:27917503 Krt7 Mouse rac-lactic acid decreases expression ISO KRT7 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of KRT7 mRNA CTD PMID:30851411 Krt7 Mouse SB 431542 increases expression ISO KRT7 (Homo sapiens) 6480464 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide results in increased expression of KRT7 protein CTD PMID:25670856 Krt7 Mouse SB 431542 multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NOG protein co-treated with entinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Krt7 Mouse SCH 23390 multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [Methamphetamine co-treated with SCH 23390] results in decreased expression of KRT7 mRNA CTD PMID:19564919 Krt7 Mouse SCH 23390 decreases expression ISO Krt7 (Rattus norvegicus) 6480464 SCH 23390 results in decreased expression of KRT7 mRNA CTD PMID:19564919 Krt7 Mouse selenium atom increases expression ISO KRT7 (Homo sapiens) 6480464 Selenium results in increased expression of KRT7 mRNA CTD PMID:19244175 Krt7 Mouse silicon dioxide affects secretion ISO KRT7 (Homo sapiens) 6480464 Silicon Dioxide analog affects the secretion of KRT7 protein CTD PMID:25895662 Krt7 Mouse silicon dioxide increases expression ISO KRT7 (Homo sapiens) 6480464 Silicon Dioxide results in increased expression of KRT7 protein CTD PMID:27917503 Krt7 Mouse silver atom increases expression ISO KRT7 (Homo sapiens) 6480464 Silver results in increased expression of KRT7 mRNA CTD PMID:28959546 Krt7 Mouse silver atom affects expression EXP 6480464 Silver affects the expression of KRT7 mRNA CTD PMID:27131904 Krt7 Mouse silver(0) increases expression ISO KRT7 (Homo sapiens) 6480464 Silver results in increased expression of KRT7 mRNA CTD PMID:28959546 Krt7 Mouse silver(0) affects expression EXP 6480464 Silver affects the expression of KRT7 mRNA CTD PMID:27131904 Krt7 Mouse sodium arsenite multiple interactions ISO KRT7 (Homo sapiens) 6480464 [sodium arsenite affects the acetylation of H3-4 protein] which affects the methylation of KRT7 promoter CTD PMID:18448484 Krt7 Mouse sodium arsenite decreases expression ISO KRT7 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of KRT7 mRNA CTD PMID:38568856 Krt7 Mouse sodium arsenite increases expression ISO KRT7 (Homo sapiens) 6480464 sodium arsenite results in increased expression of KRT7 mRNA and sodium arsenite results in increased expression of KRT7 protein CTD PMID:19524636 Krt7 Mouse sodium chloride multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in decreased expression of KRT7 protein more ... CTD PMID:38598786 Krt7 Mouse sodium dichromate decreases expression EXP 6480464 sodium bichromate results in decreased expression of KRT7 mRNA CTD PMID:31558096 Krt7 Mouse sodium fluoride decreases expression EXP 6480464 Sodium Fluoride results in decreased expression of KRT7 protein CTD PMID:27548804 and PMID:28918527 Krt7 Mouse sotorasib multiple interactions ISO KRT7 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in increased expression of KRT7 mRNA CTD PMID:36139627 Krt7 Mouse sulfadimethoxine decreases expression ISO Krt7 (Rattus norvegicus) 6480464 Sulfadimethoxine results in decreased expression of KRT7 mRNA CTD PMID:30047161 Krt7 Mouse sulforaphane decreases expression ISO KRT7 (Homo sapiens) 6480464 sulforaphane results in decreased expression of KRT7 mRNA CTD PMID:31838189 Krt7 Mouse tamoxifen affects expression EXP 6480464 Tamoxifen affects the expression of KRT7 mRNA CTD PMID:17555576 Krt7 Mouse testosterone multiple interactions ISO Krt7 (Rattus norvegicus) 6480464 [estradiol 3-benzoate co-treated with [Testosterone co-treated with Estradiol]] results in increased expression of KRT7 mRNA CTD PMID:32741896 Krt7 Mouse tetrachloromethane increases expression ISO Krt7 (Rattus norvegicus) 6480464 Carbon Tetrachloride results in increased expression of KRT7 mRNA CTD PMID:31150632 Krt7 Mouse tetrathiomolybdate(2-) decreases expression ISO KRT7 (Homo sapiens) 6480464 tetrathiomolybdate results in decreased expression of KRT7 mRNA CTD PMID:37290678 Krt7 Mouse titanium dioxide decreases expression EXP 6480464 titanium dioxide results in decreased expression of KRT7 mRNA CTD PMID:23557971 Krt7 Mouse titanium dioxide decreases expression ISO KRT7 (Homo sapiens) 6480464 titanium dioxide results in decreased expression of KRT7 protein CTD PMID:30910687 Krt7 Mouse trametinib multiple interactions ISO KRT7 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in increased expression of KRT7 mRNA CTD PMID:36139627 Krt7 Mouse triptonide increases expression EXP 6480464 triptonide results in increased expression of KRT7 mRNA CTD PMID:33045310 Krt7 Mouse valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of KRT7 mRNA CTD PMID:17292431 Krt7 Mouse valproic acid multiple interactions ISO KRT7 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of KRT7 mRNA CTD PMID:27188386 Krt7 Mouse valproic acid increases expression ISO KRT7 (Homo sapiens) 6480464 Valproic Acid results in increased expression of KRT7 mRNA CTD PMID:23179753 more ... Krt7 Mouse valproic acid decreases expression ISO KRT7 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of KRT7 mRNA CTD PMID:29154799 Krt7 Mouse vancomycin decreases expression EXP 6480464 Vancomycin results in decreased expression of KRT7 mRNA CTD PMID:18930951 Krt7 Mouse vinclozolin affects expression ISO Krt7 (Rattus norvegicus) 6480464 vinclozolin affects the expression of KRT7 mRNA CTD PMID:19015723 Krt7 Mouse vincristine increases expression ISO KRT7 (Homo sapiens) 6480464 Vincristine results in increased expression of KRT7 mRNA CTD PMID:23649840 Krt7 Mouse zearalenone increases expression ISO Krt7 (Rattus norvegicus) 6480464 Zearalenone results in increased expression of KRT7 mRNA CTD PMID:17557909 Krt7 Mouse zidovudine multiple interactions ISO KRT7 (Homo sapiens) 6480464 [Zidovudine co-treated with Lamivudine] results in increased expression of KRT7 mRNA CTD PMID:15784690
(-)-demecolcine (ISO) 1,1-dichloroethene (EXP) 1,2-dimethylhydrazine (EXP) 1-naphthyl isothiocyanate (ISO) 17alpha-ethynylestradiol (EXP,ISO) 17beta-estradiol (EXP,ISO) 17beta-estradiol 3-benzoate (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-diaminotoluene (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (EXP) 2,6-dimethoxyphenol (ISO) 2-hydroxypropanoic acid (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (ISO) 3-Nitrobenzanthrone (ISO) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (EXP) 4-hydroxyphenyl retinamide (EXP) 6-propyl-2-thiouracil (ISO) 8'-apo-beta,psi-caroten-8'-al (ISO) 9-cis-retinoic acid (ISO) acrolein (ISO) actinomycin D (ISO) all-trans-4-oxoretinoic acid (ISO) all-trans-4-oxoretinol (ISO) all-trans-retinoic acid (EXP,ISO) all-trans-retinol (ISO) alpha-pinene (ISO) amitrole (ISO) ammonium chloride (ISO) aristolochic acid A (ISO) arsenite(3-) (ISO) arsenous acid (ISO) atrazine (ISO) benzo[a]pyrene (EXP,ISO) benzo[a]pyrene diol epoxide I (ISO) beta-carotene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (EXP,ISO) Butylbenzyl phthalate (ISO) cadmium atom (ISO) cadmium dichloride (ISO) calcitriol (ISO) cannabidiol (ISO) captan (EXP) carbon nanotube (EXP,ISO) chlordecone (EXP) chloropicrin (ISO) chromium(6+) (EXP) cisplatin (ISO) cobalt dichloride (ISO) copper atom (EXP,ISO) copper(0) (EXP,ISO) crocidolite asbestos (ISO) Cuprizon (ISO) cyclosporin A (ISO) diarsenic trioxide (ISO) dibutyl phthalate (ISO) dimethylselenide (ISO) dioxygen (EXP,ISO) dorsomorphin (ISO) elemental selenium (ISO) endosulfan (ISO) entinostat (ISO) folic acid (EXP) folpet (EXP) formaldehyde (ISO) furan (ISO) furfural (ISO) gentamycin (ISO) glyphosate (EXP) hydroxyl (ISO) inulin (EXP) isotretinoin (ISO) kojic acid (ISO) lamivudine (ISO) manganese(II) chloride (ISO) methamphetamine (ISO) N-nitrosomorpholine (ISO) nickel atom (ISO) nickel sulfate (EXP) Nutlin-3 (ISO) ozone (EXP,ISO) paclitaxel (ISO) paracetamol (ISO) perfluorobutyric acid (ISO) perfluorooctane-1-sulfonic acid (EXP,ISO) perfluorooctanoic acid (ISO) phenylmercury acetate (ISO) progesterone (ISO) quartz (ISO) rac-lactic acid (ISO) SB 431542 (ISO) SCH 23390 (ISO) selenium atom (ISO) silicon dioxide (ISO) silver atom (EXP,ISO) silver(0) (EXP,ISO) sodium arsenite (ISO) sodium chloride (ISO) sodium dichromate (EXP) sodium fluoride (EXP) sotorasib (ISO) sulfadimethoxine (ISO) sulforaphane (ISO) tamoxifen (EXP) testosterone (ISO) tetrachloromethane (ISO) tetrathiomolybdate(2-) (ISO) titanium dioxide (EXP,ISO) trametinib (ISO) triptonide (EXP) valproic acid (EXP,ISO) vancomycin (EXP) vinclozolin (ISO) vincristine (ISO) zearalenone (ISO) zidovudine (ISO)
1.
Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia.
Badea L, etal., Hepatogastroenterology. 2008 Nov-Dec;55(88):2016-27.
2.
Mechanisms of severe acute respiratory syndrome coronavirus-induced acute lung injury.
Gralinski LE, etal., mBio. 2013 Aug 6;4(4). pii: mBio.00271-13. doi: 10.1128/mBio.00271-13.
3.
Functional annotation of a full-length mouse cDNA collection.
Kawai J, etal., Nature. 2001 Feb 8;409(6821):685-90.
4.
Genome-wide mapping of unselected transcripts from extraembryonic tissue of 7.5-day mouse embryos reveals enrichment in the t-complex and under-representation on the X chromosome.
Ko MS, etal., Hum Mol Genet 1998 Nov;7(12):1967-78.
5.
Clinicopathological study on cholangiolocellular carcinoma suggesting hepatic progenitor cell origin.
Komuta M, etal., Hepatology. 2008 May;47(5):1544-56.
6.
MGDs mouse GO annotations
MGD data from the GO Consortium
7.
Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs.
Okazaki Y, etal., Nature. 2002 Dec 5;420(6915):563-73.
8.
The bHLH transcription factor Mist1 is required to maintain exocrine pancreas cell organization and acinar cell identity.
Pin CL, etal., J Cell Biol 2001 Nov 12;155(4):519-30. Epub 2001 Nov 5.
9.
Hague (Hag). A new mouse hair mutation with an unstable semidominant allele.
Poirier C, etal., Genetics 2002 Oct;162(2):831-40.
10.
Mouse MP Annotation Import Pipeline
RGD automated import pipeline
11.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
12.
Overexpression of neu-related lipocalin (NRL) in neu-initiated but not ras or chemically initiated rat mammary carcinomas.
Stoesz SP and Gould MN, Oncogene. 1995 Dec 7;11(11):2233-41.
13.
FOXA1 and CK7 expression in esophageal squamous cell carcinoma and its prognostic significance.
Xu Y, etal., Neoplasma. 2018 Mar 14;65(3):469-476. doi: 10.4149/neo_2018_170529N384.
Krt7 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 15 101,310,284 - 101,325,687 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 15 101,308,924 - 101,328,194 (+) Ensembl GRCm39 Ensembl GRCm38 15 101,412,403 - 101,427,806 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 15 101,411,043 - 101,430,313 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 15 101,242,834 - 101,258,237 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 15 101,240,437 - 101,255,827 (+) NCBI MGSCv36 mm8 Celera 15 103,560,951 - 103,576,262 (+) NCBI Celera Cytogenetic Map 15 F1- F2 NCBI cM Map 15 56.88 NCBI
KRT7 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 52,233,243 - 52,255,853 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 52,232,520 - 52,252,186 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 52,627,027 - 52,642,705 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 50,913,221 - 50,928,976 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 50,913,220 - 50,928,976 NCBI Celera 12 51,429,401 - 51,445,152 (+) NCBI Celera Cytogenetic Map 12 q13.13 NCBI HuRef 12 49,659,684 - 49,676,166 (+) NCBI HuRef CHM1_1 12 52,593,314 - 52,609,064 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 52,196,307 - 52,215,830 (+) NCBI T2T-CHM13v2.0
Krt7 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 7 134,407,626 - 134,423,787 (+) NCBI GRCr8 mRatBN7.2 7 132,528,881 - 132,545,052 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 7 132,528,895 - 132,545,052 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 7 134,330,597 - 134,346,874 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 7 136,560,103 - 136,576,380 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 7 136,469,880 - 136,486,169 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 7 143,059,731 - 143,075,907 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 7 143,059,764 - 143,075,907 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 7 140,861,000 - 140,877,153 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 7 140,160,829 - 140,226,474 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 7 140,237,243 - 140,252,129 (+) NCBI Celera 7 128,994,095 - 129,010,230 (+) NCBI Celera Cytogenetic Map 7 q36 NCBI
Krt7 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955547 2,533,377 - 2,598,833 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955547 2,584,425 - 2,598,770 (+) NCBI ChiLan1.0 ChiLan1.0
KRT7 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 41,946,442 - 41,962,674 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 41,943,205 - 41,958,887 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 36,514,021 - 36,529,721 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 37,291,244 - 37,307,300 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 37,291,244 - 37,307,341 (-) Ensembl panpan1.1 panPan2
KRT7 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 2,812,709 - 2,827,451 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 43,426,876 - 43,441,582 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 2,811,546 - 2,826,249 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 2,656,611 - 2,826,996 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 2,828,289 - 2,843,003 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 2,814,255 - 2,828,967 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 43,825,075 - 43,839,789 (+) NCBI UU_Cfam_GSD_1.0
Krt7 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 63,508,247 - 63,571,032 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936512 9,641,587 - 9,656,524 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936512 9,641,587 - 9,656,573 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
KRT7
KRT7 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 48,379,460 - 48,394,638 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 48,379,465 - 48,394,643 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 197,697,351 - 197,712,521 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Krt7
.
Predicted Target Of
Count of predictions: 1866 Count of miRNA genes: 777 Interacting mature miRNAs: 1019 Transcripts: ENSMUST00000068904, ENSMUST00000131069, ENSMUST00000141190, ENSMUST00000147662, ENSMUST00000153021, ENSMUST00000183401 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1300627 Sluc26_m susceptibility to lung cancer 26 (mouse) Not determined 15 70345653 104073951 Mouse 1357526 Hyplip2_m hyperlipidemia 2 (mouse) Not determined 15 12402203 102896555 Mouse 11528547 Sluc34_m susceptibility to lung cancer 34 (mouse) 15 97884933 102896555 Mouse 1301918 Skull22_m skull morphology 22 (mouse) Not determined 15 85901546 104073951 Mouse 14928306 Manh79_m mandible shape 79 (mouse) 15 78847557 104073951 Mouse 1357894 Epfpq3_m epididymal fat percentage QTL 3 (mouse) Not determined 15 78601103 102901704 Mouse 26884425 Cvht2_m cranial vault height 2, 5 week (mouse) 15 28800146 102008435 Mouse 4142060 W3q6_m weight 3 weeks QTL 6 (mouse) Not determined 78601103 102901704 Mouse 12791003 Aath8_m aortic arch atherosclerosis 8 (mouse) 15 73430144 104073951 Mouse 11530038 Sluc34b_m susceptibility to lung cancer 34b (mouse) 15 85896437 104073951 Mouse 11530037 Sluc34a_m susceptibility to lung cancer 34a (mouse) 15 85896437 104073951 Mouse 1558985 Eae32_m experimental allergic encephalomyelitis susceptibility 32 (mouse) Not determined 15 32578416 103425899 Mouse 12880411 V125Dq11_m vitamin D active form serum level QTL 11 (mouse) 15 78897881 104073951 Mouse 1300851 Heal4_m wound healing/regeneration 4 (mouse) Not determined 15 77527592 104073951 Mouse 14747011 Mancz13_m mandible centroid size 13 (mouse) 15 72382669 104073951 Mouse 10402490 Dipa5_m drug induced psychomotor activation 5 (mouse) Not determined 15 79163411 104073951 Mouse 1300726 Pitm4_m prion incubation time 4 (mouse) Not determined 15 70349271 104073951 Mouse 1302197 Bhr2_m bronchial hyperresponsiveness 2 (mouse) Not determined 15 64306334 103425899 Mouse 1302074 Bmd4_m bone mineral density 4 (mouse) Not determined 15 56186708 103425899 Mouse 4141902 Cia37_m collagen induced arthritis 37 (mouse) Not determined 15 80884933 104073951 Mouse 14700689 Carg5_m Candida albicans resistance gene 5 (mouse) 15 97697881 103008427 Mouse 4141581 Dshv1_m dorsal hippocampal volume 1 (mouse) Not determined 92788640 103425899 Mouse 26884399 Humsd1_m humerus midshaft diameter 1, 5 week (mouse) 15 48363396 101708435 Mouse 4141897 Imrfq2_m immune response to Factor IX QTL 2 (mouse) Not determined 79908940 104073951 Mouse 1301284 Cosz3_m cocaine seizure 3 (mouse) Not determined 15 80313634 104073951 Mouse 4141511 Gdcr1_m glycerolphosphate dehydrogenase regulator 1 (mouse) Not determined 82615474 104073951 Mouse 1357614 Bmca_m bile mucin accumulation (mouse) Not determined 15 85896437 104073951 Mouse 1300648 Dbsty4_m diabesity 4 (mouse) Not determined 15 70349271 104073951 Mouse 1300974 Pgia9_m proteoglycan induced arthritis 9 (mouse) Not determined 15 80884933 104073951 Mouse
D15Wsu77e
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 15 F2 UniSTS cM Map 15 58.7 UniSTS cM Map 15 61.7 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000068904 ⟹ ENSMUSP00000069900
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 15 101,310,283 - 101,328,194 (+) Ensembl GRCm38.p6 Ensembl 15 101,412,402 - 101,430,313 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000131069
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 15 101,310,330 - 101,325,670 (+) Ensembl GRCm38.p6 Ensembl 15 101,412,449 - 101,427,789 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000141190
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 15 101,308,924 - 101,309,864 (+) Ensembl GRCm38.p6 Ensembl 15 101,411,043 - 101,411,983 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000147662 ⟹ ENSMUSP00000117046
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 15 101,308,984 - 101,317,388 (+) Ensembl GRCm38.p6 Ensembl 15 101,411,103 - 101,419,507 (+) Ensembl
Ensembl Acc Id:
ENSMUST00000153021
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 15 101,308,933 - 101,310,276 (+) Ensembl GRCm38.p6 Ensembl 15 101,411,052 - 101,412,395 (+) Ensembl
RefSeq Acc Id:
NM_033073 ⟹ NP_149064
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 15 101,310,284 - 101,325,687 (+) NCBI GRCm38 15 101,412,403 - 101,427,806 (+) NCBI MGSCv37 15 101,242,834 - 101,258,237 (+) RGD Celera 15 103,560,951 - 103,576,262 (+) RGD cM Map 15 ENTREZGENE
Sequence:
GTCGCAGACTGCCTGAGGTCAGGGAGTTCGCGCTGCTCCTCGCCTCGTCCAGCCAGCTGTGTCCAGCCGCTATGTCCATCCACTTCAGCTCTCGCTCCACTGCTTACCCGGGCCGCGGGGCTCAGGTG
hide sequence
RefSeq Acc Id:
NP_149064 ⟸ NM_033073
- UniProtKB:
Q9DCV7 (UniProtKB/Swiss-Prot)
- Sequence:
MSIHFSSRSTAYPGRGAQVRLSSGRASFGSRSLYGLGSSRPRVAVRSAYGGPVGAGIREITINQSLLAPLSVDIDPTIQQVRQEEREQIKTLNNKFASFIDKVRFLEQQNKMLETKWALLQEQKSAKS
hide sequence
Ensembl Acc Id:
ENSMUSP00000069900 ⟸ ENSMUST00000068904
Ensembl Acc Id:
ENSMUSP00000117046 ⟸ ENSMUST00000147662
RGD ID: 6826134 Promoter ID: MM_KWN:19782 Type: Non-CpG SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Kidney, Lung Transcripts: OTTMUST00000069404, OTTMUST00000069405, OTTMUST00000069406 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 15 101,241,166 - 101,241,666 (+) MPROMDB
RGD ID: 6826077 Promoter ID: MM_KWN:19783 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: Kidney, Lung Transcripts: OTTMUST00000069402, OTTMUST00000069403, TC1604837_GM671 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 15 101,242,146 - 101,242,897 (-) MPROMDB
RGD ID: 8685112 Promoter ID: EPDNEW_M20586 Type: multiple initiation site Name: Krt7_1 Description: Mus musculus keratin 7 , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 15 101,412,426 - 101,412,486 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2024-08-26
Krt7
keratin 7
Krt2-7
keratin complex 2, basic, gene 7
Symbol and/or name updated
27372883 PROVISIONAL
2024-08-21
Krt2-7
keratin complex 2, basic, gene 7
Krt7
keratin 7
Symbol and/or name change
5135510 APPROVED
