Symbol:
Rpp40
Name:
ribonuclease P 40 subunit
RGD ID:
1321009
MGI Page
MGI
Description:
Predicted to enable ribonuclease P RNA binding activity. Predicted to contribute to ribonuclease MRP activity and ribonuclease P activity. Predicted to be involved in endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) and tRNA 5'-leader removal. Predicted to be part of nucleolar ribonuclease P complex and ribonuclease MRP complex. Orthologous to human RPP40 (ribonuclease P/MRP subunit p40).
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
D8Bwg1265e; MGC25944; ribonuclease P 40kDa subunit; ribonuclease P protein subunit p40; ribonuclease P1; Rn; RNaseP protein p40; Rnasep1
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
RPP40 (ribonuclease P/MRP subunit p40) HGNC
EggNOG, Ensembl, HGNC, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, Panther, PhylomeDB, Treefam
Rattus norvegicus (Norway rat):
Rpp40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Rpp40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
RPP40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
RPP40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Rpp40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
RPP40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
RPP40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Rpp40 (ribonuclease P/MRP subunit p40) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Rattus norvegicus (Norway rat):
Rpp40 (ribonuclease P/MRP subunit p40)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
RPP40 (ribonuclease P/MRP subunit p40)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
rpp40 (ribonuclease P/MRP 40 subunit)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid|ZFIN)
Xenopus tropicalis (tropical clawed frog):
rpp40
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 36,080,685 - 36,095,548 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 36,077,455 - 36,090,342 (-) Ensembl GRCm39 Ensembl GRCm38 13 35,895,104 - 35,911,565 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 35,893,472 - 35,906,359 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 35,986,973 - 35,998,216 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 35,900,937 - 35,913,812 (-) NCBI MGSCv36 mm8 Celera 13 37,009,759 - 37,021,002 (-) NCBI Celera Cytogenetic Map 13 A3.3 NCBI cM Map 13 14.44 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Rpp40 Mouse (1->4)-beta-D-glucan multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of RPP40 mRNA CTD PMID:36331819 Rpp40 Mouse 17alpha-ethynylestradiol affects expression EXP 6480464 Ethinyl Estradiol affects the expression of RPP40 mRNA CTD PMID:17555576 Rpp40 Mouse 17alpha-ethynylestradiol increases expression EXP 6480464 Ethinyl Estradiol results in increased expression of RPP40 mRNA CTD PMID:17942748 Rpp40 Mouse 17alpha-ethynylestradiol multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RPP40 mRNA CTD PMID:17942748 Rpp40 Mouse 17beta-estradiol increases expression ISO RPP40 (Homo sapiens) 6480464 Estradiol results in increased expression of RPP40 mRNA CTD PMID:31614463 Rpp40 Mouse 2,3,7,8-tetrachlorodibenzodioxine multiple interactions EXP 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of RPP40 mRNA CTD PMID:17942748 Rpp40 Mouse 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Rpp40 (Rattus norvegicus) 6480464 Tetrachlorodibenzodioxin results in increased expression of RPP40 mRNA CTD PMID:33387578 Rpp40 Mouse 2,4-dinitrotoluene affects expression ISO Rpp40 (Rattus norvegicus) 6480464 2 and 4-dinitrotoluene affects the expression of RPP40 mRNA CTD PMID:21346803 Rpp40 Mouse 2,6-dinitrotoluene affects expression ISO Rpp40 (Rattus norvegicus) 6480464 2 and 6-dinitrotoluene affects the expression of RPP40 mRNA CTD PMID:21346803 Rpp40 Mouse 2-methylcholine affects expression ISO RPP40 (Homo sapiens) 6480464 beta-methylcholine affects the expression of RPP40 mRNA CTD PMID:21179406 Rpp40 Mouse 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of RPP40 mRNA CTD PMID:18648102 Rpp40 Mouse 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of RPP40 mRNA CTD PMID:39298647 Rpp40 Mouse all-trans-retinoic acid decreases expression ISO RPP40 (Homo sapiens) 6480464 Tretinoin results in decreased expression of RPP40 mRNA CTD PMID:21934132 and PMID:33167477 Rpp40 Mouse arsane multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse arsenic atom multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse Benoxacor increases expression EXP 6480464 benoxacor results in increased expression of RPP40 mRNA CTD PMID:34850242 Rpp40 Mouse bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of RPP40 mRNA CTD PMID:26063408 Rpp40 Mouse bisphenol A decreases methylation ISO RPP40 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of RPP40 gene CTD PMID:31601247 Rpp40 Mouse bisphenol A multiple interactions ISO RPP40 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of RPP40 gene CTD PMID:31601247 Rpp40 Mouse bisphenol A decreases expression ISO RPP40 (Homo sapiens) 6480464 bisphenol A results in decreased expression of RPP40 protein CTD PMID:33376534 Rpp40 Mouse bisphenol A affects expression ISO RPP40 (Homo sapiens) 6480464 bisphenol A affects the expression of RPP40 mRNA CTD PMID:30903817 Rpp40 Mouse bisphenol A decreases expression ISO Rpp40 (Rattus norvegicus) 6480464 bisphenol A results in decreased expression of RPP40 mRNA CTD PMID:25181051 and PMID:34947998 Rpp40 Mouse carbon nanotube increases expression EXP 6480464 Nanotubes and Carbon results in increased expression of RPP40 mRNA CTD PMID:25554681 Rpp40 Mouse copper atom multiple interactions EXP 6480464 MT1 affects the reaction [Copper results in increased expression of RPP40 mRNA] and MT2 affects the reaction [Copper results in increased expression of RPP40 mRNA] CTD PMID:16629173 Rpp40 Mouse copper(0) multiple interactions EXP 6480464 MT1 affects the reaction [Copper results in increased expression of RPP40 mRNA] and MT2 affects the reaction [Copper results in increased expression of RPP40 mRNA] CTD PMID:16629173 Rpp40 Mouse cyclosporin A decreases expression ISO RPP40 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of RPP40 mRNA CTD PMID:22147139 Rpp40 Mouse cyclosporin A increases expression ISO RPP40 (Homo sapiens) 6480464 Cyclosporine results in increased expression of RPP40 mRNA CTD PMID:20106945 and PMID:25562108 Rpp40 Mouse cylindrospermopsin increases expression ISO RPP40 (Homo sapiens) 6480464 cylindrospermopsin results in increased expression of RPP40 mRNA CTD PMID:24921660 Rpp40 Mouse deguelin increases expression ISO RPP40 (Homo sapiens) 6480464 deguelin results in increased expression of RPP40 mRNA CTD PMID:33512557 Rpp40 Mouse Dibutyl phosphate affects expression ISO RPP40 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of RPP40 mRNA CTD PMID:37042841 Rpp40 Mouse dibutyl phthalate decreases expression EXP 6480464 Dibutyl Phthalate results in decreased expression of RPP40 mRNA CTD PMID:21266533 Rpp40 Mouse dicrotophos decreases expression ISO RPP40 (Homo sapiens) 6480464 dicrotophos results in decreased expression of RPP40 mRNA CTD PMID:28302478 Rpp40 Mouse disodium selenite increases expression ISO RPP40 (Homo sapiens) 6480464 Sodium Selenite results in increased expression of RPP40 mRNA CTD PMID:18175754 Rpp40 Mouse dorsomorphin multiple interactions ISO RPP40 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RPP40 mRNA CTD PMID:27188386 Rpp40 Mouse ethanol increases expression EXP 6480464 Ethanol results in increased expression of RPP40 mRNA CTD PMID:30319688 Rpp40 Mouse finasteride increases expression ISO Rpp40 (Rattus norvegicus) 6480464 Finasteride results in increased expression of RPP40 mRNA CTD PMID:24136188 Rpp40 Mouse flutamide increases expression ISO Rpp40 (Rattus norvegicus) 6480464 Flutamide results in increased expression of RPP40 mRNA CTD PMID:24136188 Rpp40 Mouse fulvestrant multiple interactions ISO RPP40 (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of RPP40 gene CTD PMID:31601247 Rpp40 Mouse gentamycin increases expression ISO Rpp40 (Rattus norvegicus) 6480464 Gentamicins results in increased expression of RPP40 mRNA CTD PMID:22061828 Rpp40 Mouse hydrogen peroxide affects expression ISO RPP40 (Homo sapiens) 6480464 Hydrogen Peroxide affects the expression of RPP40 mRNA CTD PMID:20044591 Rpp40 Mouse isotretinoin decreases expression ISO RPP40 (Homo sapiens) 6480464 Isotretinoin results in decreased expression of RPP40 mRNA CTD PMID:20436886 Rpp40 Mouse lead diacetate increases expression EXP 6480464 lead acetate results in increased expression of RPP40 mRNA CTD PMID:21829687 Rpp40 Mouse manganese atom multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse manganese(0) multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse manganese(II) chloride multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse nickel atom increases expression ISO RPP40 (Homo sapiens) 6480464 Nickel results in increased expression of RPP40 mRNA CTD PMID:25583101 Rpp40 Mouse okadaic acid increases expression ISO RPP40 (Homo sapiens) 6480464 Okadaic Acid results in increased expression of RPP40 mRNA CTD PMID:38832940 Rpp40 Mouse perfluorononanoic acid increases expression ISO RPP40 (Homo sapiens) 6480464 perfluoro-n-nonanoic acid results in increased expression of RPP40 mRNA CTD PMID:32588087 Rpp40 Mouse perfluorooctane-1-sulfonic acid multiple interactions EXP 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of RPP40 mRNA CTD PMID:36331819 Rpp40 Mouse picoxystrobin increases expression ISO RPP40 (Homo sapiens) 6480464 picoxystrobin results in increased expression of RPP40 mRNA CTD PMID:33512557 Rpp40 Mouse pirinixic acid increases expression EXP 6480464 pirinixic acid results in increased expression of RPP40 mRNA CTD PMID:18301758 Rpp40 Mouse quercetin decreases expression ISO RPP40 (Homo sapiens) 6480464 Quercetin results in decreased expression of RPP40 mRNA CTD PMID:21632981 Rpp40 Mouse SB 431542 multiple interactions ISO RPP40 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RPP40 mRNA CTD PMID:27188386 Rpp40 Mouse silicon dioxide increases expression ISO RPP40 (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of RPP40 mRNA CTD PMID:25895662 Rpp40 Mouse sodium arsenite increases expression ISO RPP40 (Homo sapiens) 6480464 sodium arsenite results in increased expression of RPP40 mRNA CTD PMID:22714537 Rpp40 Mouse sodium arsenite multiple interactions ISO RPP40 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of RPP40 mRNA CTD PMID:39836092 Rpp40 Mouse sodium arsenite decreases expression ISO RPP40 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of RPP40 mRNA CTD PMID:38568856 Rpp40 Mouse T-2 toxin increases expression ISO RPP40 (Homo sapiens) 6480464 T-2 Toxin results in increased expression of RPP40 mRNA CTD PMID:34581912 Rpp40 Mouse tamoxifen affects expression EXP 6480464 Tamoxifen affects the expression of RPP40 mRNA CTD PMID:17555576 Rpp40 Mouse temozolomide increases expression ISO RPP40 (Homo sapiens) 6480464 Temozolomide results in increased expression of RPP40 mRNA CTD PMID:31758290 Rpp40 Mouse tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of RPP40 mRNA CTD PMID:31919559 Rpp40 Mouse trichostatin A affects expression ISO RPP40 (Homo sapiens) 6480464 trichostatin A affects the expression of RPP40 mRNA CTD PMID:28542535 Rpp40 Mouse triphenyl phosphate affects expression ISO RPP40 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of RPP40 mRNA CTD PMID:37042841 Rpp40 Mouse triptonide decreases expression EXP 6480464 triptonide results in decreased expression of RPP40 mRNA CTD PMID:33045310 Rpp40 Mouse tunicamycin increases expression ISO RPP40 (Homo sapiens) 6480464 Tunicamycin results in increased expression of RPP40 mRNA CTD PMID:22378314 Rpp40 Mouse valproic acid affects expression EXP 6480464 Valproic Acid affects the expression of RPP40 mRNA CTD PMID:17963808 Rpp40 Mouse valproic acid affects expression ISO RPP40 (Homo sapiens) 6480464 Valproic Acid affects the expression of RPP40 mRNA CTD PMID:25979313 Rpp40 Mouse valproic acid increases expression ISO RPP40 (Homo sapiens) 6480464 Valproic Acid results in increased expression of RPP40 mRNA CTD PMID:23179753 and PMID:26272509 Rpp40 Mouse valproic acid multiple interactions ISO RPP40 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in increased expression of RPP40 mRNA CTD PMID:27188386
Imported Annotations - KEGG (archival)
(1->4)-beta-D-glucan (EXP) 17alpha-ethynylestradiol (EXP) 17beta-estradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-dinitrotoluene (ISO) 2,6-dinitrotoluene (ISO) 2-methylcholine (ISO) 4,4'-diaminodiphenylmethane (EXP) 4,4'-sulfonyldiphenol (EXP) all-trans-retinoic acid (ISO) arsane (ISO) arsenic atom (ISO) Benoxacor (EXP) bisphenol A (EXP,ISO) carbon nanotube (EXP) copper atom (EXP) copper(0) (EXP) cyclosporin A (ISO) cylindrospermopsin (ISO) deguelin (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP) dicrotophos (ISO) disodium selenite (ISO) dorsomorphin (ISO) ethanol (EXP) finasteride (ISO) flutamide (ISO) fulvestrant (ISO) gentamycin (ISO) hydrogen peroxide (ISO) isotretinoin (ISO) lead diacetate (EXP) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) nickel atom (ISO) okadaic acid (ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (EXP) picoxystrobin (ISO) pirinixic acid (EXP) quercetin (ISO) SB 431542 (ISO) silicon dioxide (ISO) sodium arsenite (ISO) T-2 toxin (ISO) tamoxifen (EXP) temozolomide (ISO) tetrachloromethane (EXP) trichostatin A (ISO) triphenyl phosphate (ISO) triptonide (EXP) tunicamycin (ISO) valproic acid (EXP,ISO)
Rpp40 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 13 36,080,685 - 36,095,548 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 13 36,077,455 - 36,090,342 (-) Ensembl GRCm39 Ensembl GRCm38 13 35,895,104 - 35,911,565 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 13 35,893,472 - 35,906,359 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 13 35,986,973 - 35,998,216 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 13 35,900,937 - 35,913,812 (-) NCBI MGSCv36 mm8 Celera 13 37,009,759 - 37,021,002 (-) NCBI Celera Cytogenetic Map 13 A3.3 NCBI cM Map 13 14.44 NCBI
RPP40 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 4,988,426 - 5,004,037 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 4,994,717 - 5,004,063 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 4,994,951 - 5,004,271 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 4,940,279 - 4,949,270 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 4,940,279 - 4,949,270 NCBI Celera 6 6,224,004 - 6,232,997 (-) NCBI Celera Cytogenetic Map 6 p25.1 NCBI HuRef 6 4,871,613 - 4,880,606 (-) NCBI HuRef CHM1_1 6 4,997,633 - 5,006,608 (-) NCBI CHM1_1 T2T-CHM13v2.0 6 4,855,789 - 4,873,023 (-) NCBI T2T-CHM13v2.0
Rpp40 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 17 29,153,203 - 29,162,241 (+) NCBI GRCr8 mRatBN7.2 17 28,947,752 - 28,956,788 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 17 28,947,734 - 28,956,788 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 17 28,807,889 - 28,816,921 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 17 30,411,435 - 30,420,467 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 17 28,783,409 - 28,792,437 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 17 29,638,647 - 29,647,709 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 17 29,638,677 - 29,647,763 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 17 31,534,547 - 31,543,593 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 17 35,249,263 - 35,257,891 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 17 35,252,103 - 35,260,731 (+) NCBI Celera 17 28,549,277 - 28,557,686 (+) NCBI Celera Cytogenetic Map 17 p12 NCBI
Rpp40 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955465 8,540,459 - 8,550,249 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955465 8,540,500 - 8,550,255 (+) NCBI ChiLan1.0 ChiLan1.0
RPP40 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 19,623,806 - 19,632,422 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 15,627,775 - 15,636,370 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 4,828,155 - 4,838,680 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 5,015,953 - 5,024,540 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 5,015,953 - 5,024,540 (-) Ensembl panpan1.1 panPan2
RPP40 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 35 5,109,324 - 5,119,713 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 35 5,109,658 - 5,120,294 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 35 5,118,469 - 5,128,320 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 35 5,181,170 - 5,191,232 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 35 5,181,173 - 5,191,799 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 35 5,046,009 - 5,056,067 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 35 5,071,013 - 5,081,115 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 35 6,403,016 - 6,413,078 (-) NCBI UU_Cfam_GSD_1.0
Rpp40 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 19,202,211 - 19,211,477 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936534 7,471,198 - 7,480,475 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936534 7,471,209 - 7,480,457 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
RPP40
RPP40 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 17 67,172,759 - 67,181,669 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 17 67,173,130 - 67,181,975 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666044 4,945,666 - 4,954,176 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Rpp40
.
Predicted Target Of
Count of predictions: 2188 Count of miRNA genes: 774 Interacting mature miRNAs: 960 Transcripts: ENSMUST00000171686, ENSMUST00000174230, ENSMUST00000174231, ENSMUST00000174852 Prediction methods: Microtar, Miranda, Rnahybrid Result types: miRGate_prediction
1357591 Tesq1_m testis weight QTL 1 (mouse) Not determined 13 20615512 55720517 Mouse 1301015 Sysbp2_m systolic blood pressure 2 (mouse) Not determined 13 20477612 59821605 Mouse 12738439 Twq4_m testis weight QTL 4 (mouse) 13 31129110 65129110 Mouse 4142009 Pregq3_m pregnancy QTL 3 (mouse) Not determined 13 20615512 72385189 Mouse 10401111 Pgia40_m proteoglycan induced arthritis 40 (mouse) Not determined 13 27918469 61918560 Mouse 10412235 Scgq5_m spontaneous crescentic glomerulonephritis QTL 5 (mouse) Not determined 13 36060908 96239162 Mouse 10755517 Chol15_m cholesterol 15 (mouse) 13 30969467 64969467 Mouse 1301455 Bmd3_m bone mineral density 3 (mouse) Not determined 13 3477612 37477820 Mouse 10045625 Heal23_m wound healing/regeneration 23 (mouse) Not determined 13 3477612 37477820 Mouse 10402494 Igmsc1_m immunoglobulin M secreting cells 1 (mouse) Not determined 13 17168545 44918560 Mouse 13463469 Gssq1_m glomerulosclerosis severity QTL 1 (mouse) 13 19060908 53061050 Mouse 1301299 Sluc23_m susceptibility to lung cancer 23 (mouse) Not determined 13 34921943 68922081 Mouse 10045624 Heal24_m wound healing/regeneration (mouse) Not determined 13 3477612 37477820 Mouse 12880423 V25Dq7_m vitamin D inactive form serum level QTL 7 (mouse) 13 19583983 53583983 Mouse 1301367 Twq1_m testis weight QTL 1 (mouse) Not determined 13 3615512 37615672 Mouse 1558898 Hpi1_m hapatic PMN infiltration 1 (mouse) Not determined 13 4414025 53101640 Mouse 4142489 Ath25_m atherosclerosis 25 (mouse) Not determined 25836529 59836529 Mouse 10755533 Chol18_m cholesterol 18 (mouse) 13 30969467 64969467 Mouse 1301880 Hypt_m hypertension (mouse) Not determined 13 18156792 52156924 Mouse 10045618 Heal17_m wound healing/regeneration 17 (mouse) Not determined 13 20746939 54747056 Mouse 10045621 Heal21_m wound healing/regeneration 21 (mouse) Not determined 13 28217379 62217515 Mouse 26884393 Humsd7_m humerus midshaft diameter 7, 16 week (mouse) 13 3950000 76048119 Mouse 1301984 Pbd2_m peak bone density 2 (mouse) Not determined 13 17189508 38947406 Mouse 1300710 Pcd4ts2_m p-glycoprotein positive CD4 T cell subset 2 (mouse) Not determined 13 28210442 62210544 Mouse 1301733 Heal3_m wound healing/regeneration 3 (mouse) Not determined 13 3680200 37680343 Mouse 14696729 Kidlq2_m kidney weight, left QTL 2 (mouse) 13 31344736 65344736 Mouse 4142147 Mvwf4_m modifier of von Willebrand factor 4 (mouse) Not determined 20477612 112898424 Mouse 1357802 Vtbt15_m vertebral trabecular bone trait 15 (mouse) Not determined 13 28217379 62217515 Mouse
Rpp40
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 13 A3.3 UniSTS
Rnasep1
Mouse Assembly Chr Position (strand) Source JBrowse Cytogenetic Map 13 A3.3 UniSTS cM Map 8 25.0 UniSTS cM Map 13 UniSTS cM Map 8 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000171686 ⟹ ENSMUSP00000130290
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 36,077,455 - 36,090,342 (-) Ensembl GRCm38.p6 Ensembl 13 35,893,472 - 35,906,359 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000174230 ⟹ ENSMUSP00000134228
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 36,080,698 - 36,090,327 (-) Ensembl GRCm38.p6 Ensembl 13 35,896,715 - 35,906,344 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000174231 ⟹ ENSMUSP00000134210
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 36,080,687 - 36,082,851 (-) Ensembl GRCm38.p6 Ensembl 13 35,896,704 - 35,898,868 (-) Ensembl
Ensembl Acc Id:
ENSMUST00000174852
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 13 36,080,695 - 36,090,311 (-) Ensembl GRCm38.p6 Ensembl 13 35,896,712 - 35,906,328 (-) Ensembl
RefSeq Acc Id:
NM_001426380 ⟹ NP_001413309
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426381 ⟹ NP_001413310
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426382 ⟹ NP_001413311
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426383 ⟹ NP_001413312
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426384 ⟹ NP_001413313
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426385 ⟹ NP_001413314
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_001426386 ⟹ NP_001413315
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI
RefSeq Acc Id:
NM_145938 ⟹ NP_666050
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,687 - 36,090,329 (-) NCBI GRCm38 13 35,895,104 - 35,906,347 (-) NCBI MGSCv37 13 35,986,973 - 35,998,216 (-) RGD Celera 13 37,009,759 - 37,021,002 (-) RGD cM Map 13 ENTREZGENE
Sequence:
TCGCCTGGACTCCTGCTTAACATGGCCACGCTGCGCAGGCTGCAAGAGGCGCCTCGGCACTTACTGGTCTGTGAGAAATCCAACTTCGGCCACGATAAGTCTCGCCATAAGCATCTCGTGGAGACGCA
hide sequence
RefSeq Acc Id:
XM_006516631 ⟹ XP_006516694
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,685 - 36,090,010 (-) NCBI GRCm38 13 35,896,702 - 35,906,027 (-) NCBI
Sequence:
TACAATTCCCAGCATGCGCCAAACACAGGGCGGTGCTCGGTCCTATGAGGAACAGCAGAGTTTT
hide sequence
RefSeq Acc Id:
XM_011244302 ⟹ XP_011242604
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 13 36,080,685 - 36,095,548 (-) NCBI GRCm38 13 35,896,702 - 35,911,565 (-) NCBI
Sequence:
TACTGAATTAGAATTCTCAGGTTTCATTTCTTATTCCTGAATGTGGGCTTCTATCAAAAGAGCTAAAAAGCCTGGTCATGGACATTGGACCCTATTACTCTGTGAAGAACTTACCTCTTCATGAATTA
hide sequence
RefSeq Acc Id:
NP_666050 ⟸ NM_145938
- Peptide Label:
isoform 1
- UniProtKB:
Q8R1F9 (UniProtKB/Swiss-Prot), Q8BX66 (UniProtKB/Swiss-Prot)
- Sequence:
MATLRRLQEAPRHLLVCEKSNFGHDKSRHKHLVETHYHNYRVSFLIPECGLLSKELKSLVMDIGPYYSVKNLPLHELITHEFINTFVKKGSFSALTYNTSIDEDNTVALLPNGKLILSLDKDTYEETG
hide sequence
RefSeq Acc Id:
XP_006516694 ⟸ XM_006516631
- Peptide Label:
isoform X1
- Sequence:
MRNSRVFVSFLIPECGLLSKELKSLVMDIGPYYSVKNLPLHELITHEFINTFVKKGSFSALTYNTSIDEDNTVALLPNGKLILSLDKDTYEETGLQGRPSRYSGRKSMKFVISIDLMDLSLNLDSKKY
hide sequence
RefSeq Acc Id:
XP_011242604 ⟸ XM_011244302
- Peptide Label:
isoform X2
- Sequence:
MDIGPYYSVKNLPLHELITHEFINTFVKKGSFSALTYNTSIDEDNTVALLPNGKLILSLDKDTYEETGLQGRPSRYSGRKSMKFVISIDLMDLSLNLDSKKYRRISWSFKEKKPLKFDFLLAWHPTGT
hide sequence
Ensembl Acc Id:
ENSMUSP00000130290 ⟸ ENSMUST00000171686
Ensembl Acc Id:
ENSMUSP00000134228 ⟸ ENSMUST00000174230
Ensembl Acc Id:
ENSMUSP00000134210 ⟸ ENSMUST00000174231
RefSeq Acc Id:
NP_001413313 ⟸ NM_001426384
- Peptide Label:
isoform 6
- UniProtKB:
G3UYU5 (UniProtKB/TrEMBL)
RefSeq Acc Id:
NP_001413312 ⟸ NM_001426383
- Peptide Label:
isoform 5
RefSeq Acc Id:
NP_001413311 ⟸ NM_001426382
- Peptide Label:
isoform 4
RefSeq Acc Id:
NP_001413310 ⟸ NM_001426381
- Peptide Label:
isoform 3
RefSeq Acc Id:
NP_001413314 ⟸ NM_001426385
- Peptide Label:
isoform 7
RefSeq Acc Id:
NP_001413309 ⟸ NM_001426380
- Peptide Label:
isoform 2
RefSeq Acc Id:
NP_001413315 ⟸ NM_001426386
- Peptide Label:
isoform 8
RGD ID: 8680096 Promoter ID: EPDNEW_M18079 Type: multiple initiation site Name: Rpp40_1 Description: Mus musculus ribonuclease P 40 subunit , mRNA. SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Mouse Assembly Chr Position (strand) Source GRCm38 13 35,906,345 - 35,906,405 EPDNEW
RGD ID: 6824339 Promoter ID: MM_KWN:13816 Type: CpG-Island SO ACC ID: SO:0000170 Source: MPROMDB Tissues & Cell Lines: 3T3L1_Day2, BoneMarrow_0Hour, BoneMarrow_2Hour, BoneMarrow_4Hour, Brain, ES_Cell, Kidney, Liver, Lung, MEF_B4, MEF_B6, Spleen Transcripts: UC007QCH.1 Position: Mouse Assembly Chr Position (strand) Source MGSCv36 13 35,997,679 - 35,998,179 (-) MPROMDB
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2024-08-26
Rpp40
ribonuclease P 40 subunit
Rnasep1
ribonuclease P1
Symbol and/or name updated
27372883 PROVISIONAL
2024-08-21
Rnasep1
ribonuclease P1
Rpp40
ribonuclease P 40 subunit
Symbol and/or name change
5135510 APPROVED
2012-11-27
Rpp40
ribonuclease P 40 subunit
ribonuclease P 40 subunit (human)
Symbol and/or name change
5135510 APPROVED
