Advanced Search (OLGA)

Gene: Mir99b (microRNA 99b) Rattus norvegicus

Analyze

Symbol:

Mir99b

Name:

microRNA 99b

RGD ID:

2325431

Description:

Predicted to enable mRNA 3'-UTR binding activity and mRNA base-pairing post-transcriptional repressor activity. Predicted to be involved in miRNA-mediated post-transcriptional gene silencing; positive regulation of angiogenesis; and positive regulation of endothelial cell differentiation. Predicted to act upstream of or within sensory perception of sound. Predicted to be part of RISC complex. Orthologous to human MIR99B (microRNA 99b); INTERACTS WITH bisphenol A; bleomycin A2; cisplatin.

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

microRNA mir-99b; rno-mir-99b

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCr8 - GRCr8 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	67,350,064 - 67,350,133 (+)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	1	67,350,060 - 67,350,139 (+)	Ensembl				GRCr8
mRatBN7.2	1	58,677,015 - 58,677,084 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	58,677,011 - 58,677,090 (+)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	1	63,501,603 - 63,501,672 (+)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	72,194,267 - 72,194,336 (+)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	65,411,649 - 65,411,718 (+)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Dahl_SR_JrHsd	1	66,844,560 - 66,844,629 (+)	NCBI		Dahl_SR_JrHsd
Lyon_Normotensive	1	71,113,021 - 71,113,090 (+)	NCBI		Lyon_Normotensive
Lyon_Hypertensive	1	68,829,087 - 68,829,156 (+)	NCBI		Lyon_Hypertensive
F344_StmMcwi	1	65,600,891 - 65,600,960 (+)	NCBI		F344_StmMcwi
Rnor_6.0	1	59,704,216 - 59,704,285 (+)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	59,704,216 - 59,704,285 (+)	Ensembl			rn6	Rnor6.0
Rnor_5.0	1	60,623,874 - 60,623,943 (+)	NCBI	Rnor_5.0	Rnor_5.0	rn5
Celera	1	54,857,973 - 54,858,042 (+)	NCBI		Celera
Cytogenetic Map	1	q12	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Acute Lung Injury (ISO)

congestive heart failure (ISO)

Experimental Liver Neoplasms (ISO)

Hearing Loss, Noise-Induced (ISO)

Neoplasm Metastasis (ISO)

Neoplastic Cell Transformation (ISO)

pre-malignant neoplasm (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

1,2-dichloroethane (ISO)

1,3,5-trinitro-1,3,5-triazinane (ISO)

17beta-estradiol (ISO)

3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione (ISO)

Aflatoxin B2 alpha (ISO)

amphotericin B (ISO)

benzene (ISO)

benzo[a]pyrene (ISO)

benzo[e]pyrene (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bisphenol A (EXP)

bleomycin A2 (EXP)

Butylbenzyl phthalate (ISO)

carbon nanotube (ISO)

cisplatin (EXP,ISO)

DDT (ISO)

decabromodiphenyl ether (ISO)

Deoxycorticosterone acetate (EXP)

formaldehyde (ISO)

furan (ISO)

hydrogen peroxide (ISO)

L-methionine (ISO)

lipopolysaccharide (ISO)

metformin (EXP)

methapyrilene (EXP,ISO)

mono(5-carboxy-2-ethylpentyl) phthalate (ISO)

monobenzyl phthalate (ISO)

morphine (ISO)

nitrofen (EXP)

paracetamol (EXP)

progesterone (ISO)

resveratrol (ISO)

sodium arsenite (EXP)

sodium aurothiomalate (ISO)

toluene (ISO)

valproic acid (ISO)

zinc atom (EXP)

zinc(0) (EXP)

zirconium atom (ISO)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of gene expression (ISO)

positive regulation of angiogenesis (ISO)

positive regulation of endothelial cell differentiation (ISO)

positive regulation of nitric oxide biosynthetic process (ISO)

sensory perception of sound (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing post-transcriptional repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:14691248	PMID:15345052	PMID:16381832	PMID:16766679	PMID:17604727	PMID:20403161	PMID:23646144	PMID:26208845	PMID:37088748	PMID:38061116

Genomics

Comparative Map Data

Mir99b
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	1	67,350,064 - 67,350,133 (+)	NCBI	GRCr8	GRCr8		GRCr8
GRCr8 Ensembl	1	67,350,060 - 67,350,139 (+)	Ensembl				GRCr8
mRatBN7.2	1	58,677,015 - 58,677,084 (+)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	1	58,677,011 - 58,677,090 (+)	Ensembl				mRatBN7.2
UTH_Rnor_SHR_Utx	1	63,501,603 - 63,501,672 (+)	NCBI	UTH_Rnor_SHR_Utx	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	1	72,194,267 - 72,194,336 (+)	NCBI	UTH_Rnor_SHRSP_BbbUtx_1.0	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	1	65,411,649 - 65,411,718 (+)	NCBI	UTH_Rnor_WKY_Bbb_1.0	UTH_Rnor_WKY_Bbb_1.0
Dahl_SR_JrHsd	1	66,844,560 - 66,844,629 (+)	NCBI		Dahl_SR_JrHsd
Lyon_Normotensive	1	71,113,021 - 71,113,090 (+)	NCBI		Lyon_Normotensive
Lyon_Hypertensive	1	68,829,087 - 68,829,156 (+)	NCBI		Lyon_Hypertensive
F344_StmMcwi	1	65,600,891 - 65,600,960 (+)	NCBI		F344_StmMcwi
Rnor_6.0	1	59,704,216 - 59,704,285 (+)	NCBI	Rnor_6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	1	59,704,216 - 59,704,285 (+)	Ensembl			rn6	Rnor6.0
Rnor_5.0	1	60,623,874 - 60,623,943 (+)	NCBI	Rnor_5.0	Rnor_5.0	rn5
Celera	1	54,857,973 - 54,858,042 (+)	NCBI		Celera
Cytogenetic Map	1	q12	NCBI

MIR99B
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	19	51,692,612 - 51,692,681 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	19	51,692,612 - 51,692,681 (+)	Ensembl			hg38	GRCh38
GRCh37	19	52,195,865 - 52,195,934 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	19	56,887,676 - 56,887,745 (+)	NCBI	Build 36	Build 36	hg18	NCBI36
Celera	19	49,245,400 - 49,245,469 (+)	NCBI		Celera
Cytogenetic Map	19	q13.41	NCBI
HuRef	19	48,526,806 - 48,526,875 (+)	NCBI		HuRef
CHM1_1	19	52,197,662 - 52,197,731 (+)	NCBI		CHM1_1
T2T-CHM13v2.0	19	54,779,775 - 54,779,844 (+)	NCBI		T2T-CHM13v2.0

Mir99b
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	17	18,050,450 - 18,050,519 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	17	18,050,450 - 18,050,519 (+)	Ensembl		GRCm39 Ensembl		GRCm39
GRCm38	17	17,830,188 - 17,830,257 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	17	17,830,188 - 17,830,257 (+)	Ensembl			mm10	GRCm38
MGSCv37	17	17,967,152 - 17,967,221 (+)	NCBI	MGSCv37	MGSCv37	mm9	NCBIm37
Celera	17	18,770,839 - 18,770,908 (+)	NCBI		Celera
Cytogenetic Map	17	A3.2	NCBI
cM Map	17	10.5	NCBI

MIR99B
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	1	105,400,925 - 105,400,984 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	1	105,400,925 - 105,400,984 (-)	Ensembl			canFam3	CanFam3.1
Dog10K_Boxer_Tasha	1	104,974,438 - 104,974,497 (-)	NCBI	Dog10K_Boxer_Tasha	Dog10K_Boxer_Tasha
ROS_Cfam_1.0	1	105,910,842 - 105,910,901 (-)	NCBI	ROS_Cfam_1.0	ROS_Cfam_1.0
ROS_Cfam_1.0 Ensembl	1	105,910,842 - 105,910,901 (-)	Ensembl				ROS_Cfam_1.0 Ensembl
UMICH_Zoey_3.1	1	105,583,074 - 105,583,133 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	1	105,224,190 - 105,224,249 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	1	106,018,965 - 106,019,024 (-)	NCBI	UU_Cfam_GSD_1.0	UU_Cfam_GSD_1.0

MIR99B
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	6	58,332,205 - 58,332,284 (-)	Ensembl			susScr11	Sscrofa11.1
Sscrofa11.1	6	58,332,211 - 58,332,280 (-)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	6	51,858,217 - 51,858,286 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

miRNA Target Status (No longer updated)

Confirmed Targets

Gene Target	Mature miRNA	Method Name	Result Type	Data Type	Support Type	PMID
Aqp4	rno-miR-99b-5p	Mirtarbase	external_info	Microarray	Functional MTI (Weak)	18258830

Predicted Targets

	Summary Value
Count of predictions:	3573
Count of gene targets:	2707
Count of transcripts:	2853
Interacting mature miRNAs:	rno-miR-99b-3p, rno-miR-99b-5p
Prediction methods:	Microtar, Miranda, Pita, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCr8)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1331732	Srn4	Serum renin concentration QTL 4	4.467		renin activity (VT:0005581)	plasma renin activity level (CMO:0000116)	1	43457837	87558729	Rat
1357397	Bw41	Body weight QTL 41	4.19	0.0001	body mass (VT:0001259)	body weight (CMO:0000012)	1	29409279	74409279	Rat
1578649	Bmd8	Bone mineral density QTL 8	4.9		femur mineral mass (VT:0010011)	trabecular volumetric bone mineral density (CMO:0001729)	1	51940904	101229020	Rat
1358359	Sradr1	Stress Responsive Adrenal Weight QTL 1	4.74		adrenal gland mass (VT:0010420)	both adrenal glands wet weight (CMO:0000164)	1	39728272	132889942	Rat
4889929	Bss87	Bone structure and strength QTL 87	6.7		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	46302615	91302615	Rat
634314	Niddm44	Non-insulin dependent diabetes mellitus QTL 44			blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	1	51941022	208479811	Rat
1331792	Rf29	Renal function QTL 29	4.589		urine potassium amount (VT:0010539)	urine potassium level (CMO:0000128)	1	43457837	87558729	Rat
2313062	Bmd73	Bone mineral density QTL 73	3.9	0.0001	tibia mineral mass (VT:1000283)	compact volumetric bone mineral density (CMO:0001730)	1	46302615	91302615	Rat
8552900	Pigfal1	Plasma insulin-like growth factor 1 level QTL 1	7.4		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	43509952	88509952	Rat
1578654	Bss10	Bone structure and strength QTL 10	4		femur morphology trait (VT:0000559)	femoral neck cortical cross-sectional area (CMO:0001702)	1	51940904	168768703	Rat
1354643	Foco2	Food consumption QTL 2	7.17	0.0001	eating behavior trait (VT:0001431)	food intake rate (CMO:0000427)	1	42122968	87122968	Rat
2313065	Bss67	Bone structure and strength QTL 67	3.1	0.0001	tibia area (VT:1000281)	tibia total energy absorbed before break (CMO:0001736)	1	46302615	91302615	Rat
2313069	Bss68	Bone structure and strength QTL 68	2.9	0.0001	tibia size trait (VT:0100001)	tibia total energy absorbed before break (CMO:0001736)	1	46302615	91302615	Rat
631495	Bp96	Blood pressure QTL 96	4.52		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	66404680	111404680	Rat
70225	Bp58	Blood pressure QTL 58	3.3		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	34184556	172281316	Rat
2313075	Bss66	Bone structure and strength QTL 66	3.4	0.0001	tibia length (VT:0004357)	tibia length (CMO:0000450)	1	46302615	91302615	Rat
2298545	Neuinf8	Neuroinflammation QTL 8	4.6		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	1	66009857	160501508	Rat
10059597	Bp377	Blood pressure QTL 377	3.42	0.025	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	34565911	208798288	Rat
1331778	Rf28	Renal function QTL 28	4.66		urine potassium amount (VT:0010539)	urine potassium excretion rate (CMO:0000761)	1	43457837	87558729	Rat
2313077	Bss69	Bone structure and strength QTL 69	3.5	0.0001	tibia strength trait (VT:1000284)	bone polar moment of inertia (CMO:0001558)	1	46302615	91302615	Rat
1302788	Scl19	Serum cholesterol QTL 19	4.6	0.001	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	66400974	132889942	Rat
2313402	Anxrr24	Anxiety related response QTL 24			aggression-related behavior trait (VT:0015014)	tameness/aggressiveness composite score (CMO:0002136)	1	51511344	153680016	Rat
1331785	Rf27	Renal function QTL 27	4.643		urine sodium amount (VT:0006274)	urine sodium level (CMO:0000129)	1	30708375	87558729	Rat
61342	Bp27	Blood pressure QTL 27	3.4	0.0006	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	1	65405637	96805205	Rat
1300172	Bp172	Blood pressure QTL 172	3.56		arterial blood pressure trait (VT:2000000)	diastolic blood pressure (CMO:0000005)	1	34565726	79565726	Rat
4889962	Bss94	Bone structure and strength QTL 94	3.8		tibia area (VT:1000281)	tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)	1	51909206	91302615	Rat
6903308	Scl36	Serum cholesterol QTL 36	2	0.0125	blood cholesterol amount (VT:0000180)	plasma total cholesterol level (CMO:0000585)	1	58769992	103769992	Rat
2313092	Bmd72	Bone mineral density QTL 72	2.5	0.0001	tibia mineral mass (VT:1000283)	total volumetric bone mineral density (CMO:0001728)	1	46302615	91302615	Rat
2300164	Bmd44	Bone mineral density QTL 44	5.4	0.0001	lumbar vertebra mineral mass (VT:0010511)	volumetric bone mineral density (CMO:0001553)	1	66077886	111077886	Rat
2313097	Bss70	Bone structure and strength QTL 70	3.5	0.0001	tibia strength trait (VT:1000284)	tibia total energy absorbed before break (CMO:0001736)	1	46302615	91302615	Rat
9589820	Insglur3	Insulin/glucose ratio QTL 3	10.75	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	1	43509952	88509952	Rat
152025249	Scl82	Serum cholesterol level QTL 82	4.77		blood cholesterol amount (VT:0000180)		1	52891222	109116986	Rat
1354599	Bw29	Body weight QTL 29	3.46	0.001	body mass (VT:0001259)	body weight (CMO:0000012)	1	42122968	87122968	Rat
4889919	Bss86	Bone structure and strength QTL 86	4.1		tibia area (VT:1000281)	tibia midshaft total cross-sectional area (CMO:0001715)	1	46302615	91302615	Rat
8552948	Pigfal11	Plasma insulin-like growth factor 1 level QTL 11	4.7		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	1	43509952	88509952	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
1	4	18	36	13	15	2	10	2	53	36	29	11	27	13

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_031857	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	JAXUCZ010000001	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000053777

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8 Ensembl	1	67,350,060 - 67,350,139 (+)	Ensembl
mRatBN7.2 Ensembl	1	58,677,011 - 58,677,090 (+)	Ensembl
Rnor_6.0 Ensembl	1	59,704,216 - 59,704,285 (+)	Ensembl

RefSeq Acc Id:

NR_031857

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	1	67,350,064 - 67,350,133 (+)	NCBI
mRatBN7.2	1	58,677,015 - 58,677,084 (+)	NCBI
Dahl_SR_JrHsd	1	66,844,560 - 66,844,629 (+)	NCBI
Lyon_Normotensive	1	71,113,021 - 71,113,090 (+)	NCBI
Lyon_Hypertensive	1	68,829,087 - 68,829,156 (+)	NCBI
F344_StmMcwi	1	65,600,891 - 65,600,960 (+)	NCBI
Rnor_6.0	1	59,704,216 - 59,704,285 (+)	NCBI
Rnor_5.0	1	60,623,874 - 60,623,943 (+)	NCBI
Celera	1	54,857,973 - 54,858,042 (+)	NCBI

Sequence:

show sequence

GGCACCCACCCGTAGAACCGACCTTGCGGGGCCTTCGCCGCACACAAGCTCGTGTCTGTGGGTC
CGTGTC

hide sequence

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:2325431	AgrOrtholog
BioCyc Gene	G2FUF-61264	BioCyc
Ensembl Genes	ENSRNOG00000035654	Ensembl, ENTREZGENE
Ensembl Transcript	ENSRNOT00000053777	ENTREZGENE
miRBase	MI0000884	ENTREZGENE
NCBI Gene	100314189	ENTREZGENE
PhenoGen	Mir99b	PhenoGen
RatGTEx	ENSRNOG00000035654	RatGTEx
RNAcentral	URS00001C308D	RNACentral
	URS00002C10B3	RNACentral
	URS000075E904	RNACentral
	URS0000D4F352	RNACentral

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2013-08-14	Mir99b	microRNA 99b	Mir99b	microRNA mir-99b	Nomenclature updated to reflect human and mouse nomenclature	1299863	APPROVED
2010-06-02	Mir99b	microRNA mir-99b			Symbol and Name status set to provisional	70820	PROVISIONAL

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD