D4Wox7 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Wox7

Symbol: D4Wox7
Previously known as: oxsts4964; RCA19.36; 
RGD ID: 60806
Expected Size: 131 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8473,752,680 - 73,752,811 (+)Marker Load Pipeline
mRatBN7.2472,752,703 - 72,752,834 (+)MAPPERmRatBN7.2
Rnor_6.0473,372,694 - 73,372,824NCBIRnor6.0
Rnor_5.04138,066,568 - 138,066,698UniSTSRnor5.0
RGSC_v3.4471,729,607 - 71,729,738RGDRGSC3.4
RGSC_v3.4471,729,608 - 71,729,738UniSTSRGSC3.4
RGSC_v3.1472,005,738 - 72,005,868RGD
Celera467,679,337 - 67,679,467UniSTS
RH 3.4 Map4437.3RGD
RH 3.4 Map4437.3UniSTS
Is Marker For: QTLs:   Eae24  




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines


 
Forward Primer GATAGCATAAAATCCCTAGAGGTT
Reverse Primer TGCATTTATCTGAAACCATCAC
 
GenBank Nucleotide AJ230855 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614589.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 58 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658103194791Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)426775591168368347Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
1549839Bw52Body weight QTL 520.0001body mass (VT:0001259)body weight gain (CMO:0000420)461697658115089733Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat

1 to 10 of 58 rows


Database
Acc Id
Source(s)
NCBI Gene 100422812 UniSTS