UniSTS:256469 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:256469

Symbol: UniSTS:256469
Previously known as:
RGD ID: 5503922
Expected Size: 848 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21183,072,798 - 83,073,646 (+)MAPPERmRatBN7.2
Rnor_6.01187,221,279 - 87,222,126NCBIRnor6.0
Rnor_5.01190,312,842 - 90,313,689UniSTSRnor5.0
RGSC_v3.41185,060,932 - 85,061,779UniSTSRGSC3.4
Celera1181,848,808 - 81,849,655UniSTS
Cytogenetic Map11q23UniSTS
Is Marker For: Genes:   Gsc2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGAGGAGCGCGTGGAG
Reverse Primer GCATCAACAACTCTCCTTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305333Gsc2goosecoid homeobox 2118307078483075874Rat

Nucleotide Sequences
RefSeq Transcripts NM_001108846 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
10058954Gmadr7Adrenal mass QTL 72.490.0049adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)116034659086241447Rat
1354593Stl12Serum triglyceride level QTL 123.36blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)116642214886241447Rat
2302043Pia27Pristane induced arthritis QTL 2718.60.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)118256654583440803Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)116642214886241447Rat
7411658Foco27Food consumption QTL 2716.20.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)115635142486241447Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 363831 UniSTS