AU049521 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AU049521

Symbol: AU049521
Previously known as:
RGD ID: 5090051
Expected Size: 162 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8150,851,486 - 50,851,648 (+)Marker Load Pipeline
mRatBN7.2148,303,745 - 48,303,907 (+)MAPPERmRatBN7.2
Rnor_6.0148,500,311 - 48,500,472NCBIRnor6.0
Rnor_5.0151,254,243 - 51,254,404UniSTSRnor5.0
RGSC_v3.4142,760,171 - 42,760,332UniSTSRGSC3.4
Celera144,095,535 - 44,095,696UniSTS
Cytogenetic Map1q11UniSTS
Is Marker For: Genes:   Slc22a3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCTCCAAACCCCTTCTCAAA
Reverse Primer TCGATCATATACACTCGAACAACAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3701Slc22a3solute carrier family 22 member 315078321850872358Rat

Nucleotide Sequences
GenBank Nucleotide AU049521 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1331732Srn4Serum renin concentration QTL 44.467renin activity (VT:0005581)plasma renin activity level (CMO:0000116)14345783787558729Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1774611852746118Rat
1357397Bw41Body weight QTL 414.190.0001body mass (VT:0001259)body weight (CMO:0000012)12940927974409279Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)139728272132889942Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14630261591302615Rat
1331792Rf29Renal function QTL 294.589urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)14345783787558729Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)14630261591302615Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)14350995288509952Rat
1354643Foco2Food consumption QTL 27.170.0001eating behavior trait (VT:0001431)food intake rate (CMO:0000427)14212296887122968Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1694102251941022Rat
1357401Bw43Body weight QTL 433.75body mass (VT:0001259)body weight (CMO:0000012)1690935351909353Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
631494Bp95Blood pressure QTL 95400.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)11731537851816258Rat
5684998Bss101Bone structure and strength QTL 1013.6tibia strength trait (VT:1000284)tibia ultimate force (CMO:0001734)1690935351909353Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134184556172281316Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)14630261591302615Rat
5684999Bss102Bone structure and strength QTL 1025.57e-07tibia strength trait (VT:1000284)tibia stiffness (CMO:0001735)1690935351909353Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134565911208798288Rat
1331778Rf28Renal function QTL 284.66urine potassium amount (VT:0010539)urine potassium excretion rate (CMO:0000761)14345783787558729Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)14630261591302615Rat
1578756Iddm22Insulin dependent diabetes mellitus QTL 222.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)12050832665508326Rat
631508Sald1Serum aldosterone level QTL 13.7blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)11168446456684464Rat
1331785Rf27Renal function QTL 274.643urine sodium amount (VT:0006274)urine sodium level (CMO:0000129)13070837587558729Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13456572679565726Rat
4889451Eae29Experimental allergic encephalomyelitis QTL 295.51nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1774612152746121Rat
1558642Prcr2Prostate cancer resistance QTL 24.3prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)11037949255379492Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)14630261591302615Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)14630261591302615Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)14350995288509952Rat
1354599Bw29Body weight QTL 293.460.001body mass (VT:0001259)body weight (CMO:0000012)14212296887122968Rat
2302038Pia31Pristane induced arthritis QTL 315.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)11282049457820494Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)14630261591302615Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)14350995288509952Rat
634353Rends2Renal damage susceptibility QTL 20.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)12065642065656420Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29504 UniSTS