RH138705 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH138705

Symbol: RH138705
Previously known as: AA925903; 
RGD ID: 5075630
Expected Size: 231 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22247,146,500 - 247,146,731 (+)MAPPERmRatBN7.2
Rnor_6.02264,909,343 - 264,909,573NCBIRnor6.0
Rnor_5.02283,548,631 - 283,548,861UniSTSRnor5.0
RGSC_v3.42256,227,541 - 256,227,771UniSTSRGSC3.4
Celera2238,946,722 - 238,946,952UniSTS
RH 3.4 Map21643.7UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCACACGTGGATGTCACCAG
Reverse Primer ATGGTATTGTGTCATCCTGGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
708527Lrrc7leucine rich repeat containing 72247146616247634945Rat

Nucleotide Sequences
GenBank Nucleotide AC117096 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH613914.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2211744537249053267Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2223389739249053267Rat
631563Hcuc3Hepatic copper content QTL 33.87liver copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2229059610249053267Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2223389739249053267Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2211744537249053267Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2211744537249053267Rat
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2149559561249053267Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2211744537249053267Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2212828222249053267Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2211744537249053267Rat


Additional Information