AU046944 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: AU046944

Symbol: AU046944
Previously known as:
RGD ID: 5068768
Expected Size: 91 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21448,202,338 - 48,202,424 (+)MAPPERmRatBN7.2
Rnor_6.01450,232,044 - 50,232,129NCBIRnor6.0
Rnor_5.01450,394,295 - 50,394,380UniSTSRnor5.0
RGSC_v3.41452,233,201 - 52,233,286UniSTSRGSC3.4
Celera1447,488,265 - 47,488,350UniSTS




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer TGCGTGAGTGTGTGTGTGC
Reverse Primer ATTTAGAAATGTAAACCTACACAT
 
GenBank Nucleotide AU046944 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618120.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


1 to 10 of 17 rows
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD ID
Symbol
Name
LOD
P Value
Trait
Sub Trait
Chr
Start
Stop
Species
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
70214Niddm28Non-insulin dependent diabetes mellitus QTL 284.06blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)143999825175582726Rat
1300154Bp189Blood pressure QTL 1893.04arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)143088377768757901Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
7387267Uae42Urinary albumin excretion QTL 420.61urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)142216796767167967Rat

1 to 10 of 17 rows