BF403356 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: BF403356

Symbol: BF403356
Also known as:
RGD ID: 5062522
Expected Size: 104 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.02252,310,527 - 252,310,630NCBIRnor6.0
Rnor_5.02270,837,491 - 270,837,594UniSTSRnor5.0
RGSC_v3.42244,653,018 - 244,653,121UniSTSRGSC3.4
Celera2227,324,966 - 227,325,069UniSTS
Cytogenetic Map2q44UniSTS
Is Marker For: Genes:   Ctbs  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGTGCTGCAGACACGAGGATAG
Reverse Primer AGAGTTTCTGCACACACTTCGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621338Ctbschitobiase2252305874252320387Rat

Nucleotide Sequences
GenBank Nucleotide AC142185 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1641891Alcrsp17Alcohol response QTL 17response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2155965557254121739Rat
2317752Glom23Glomerulus QTL 233.6urine protein amount (VT:0005160)urine protein level (CMO:0000591)2208594330263179188Rat
2298479Eau5Experimental allergic uveoretinitis QTL 50.0021uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)2217498545254132424Rat
1598835Anxrr18Anxiety related response QTL 182.98body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)2217743855262743855Rat
2299161Iddm33Insulin dependent diabetes mellitus QTL 332.98blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)2221488355254121739Rat
1298075Scl17Serum cholesterol level QTL 173.4blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)2228712271266435125Rat
1549836Bss2Bone structure and strength QTL 27.5femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)2228712271266435125Rat
7207482Bss107Bone structure and strength QTL 1077femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)2228712271266435125Rat
7207484Bss108Bone structure and strength QTL 1085.3femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)2228712271266435125Rat
7207490Bss111Bone structure and strength QTL 1116.4femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)2228712271266435125Rat
1300126Bp175Blood pressure QTL 1753.46arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2229606682264899009Rat
2317885Alcrsp28Alcohol response QTL 282.10.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)2229793522266435125Rat
2313073Bmd75Bone mineral density QTL 754.10.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)2231224020254132424Rat
631514Scl8Serum cholesterol level QTL84.4blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)2231621666266435125Rat
8693697Alc36Alcohol consumption QTL 3620.592drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2233013605253626471Rat
1331767Hrtrt12Heart rate QTL 123.373heart pumping trait (VT:2000009)heart rate (CMO:0000002)2235289967257110527Rat
2293833Kiddil8Kidney dilation QTL 82.9kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2236318496264899009Rat
2293844Kiddil7Kidney dilation QTL 73.5kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)2236318496264899009Rat
8693622Alc26Alcohol consumption QTL 262.40.667drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)2237712398257579826Rat
9587428Epfw6Epididymal fat weight QTL 67.470.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)2240679103266435125Rat
7411555Bw132Body weight QTL 1320.001body mass (VT:0001259)body weight gain (CMO:0000420)2240679103266435125Rat
631563Hcuc3Hepatic copper content QTL 33.87hepatic copper amount (VT:0003065)liver copper weight to liver dry weight ratio (CMO:0001512)2245893572266435125Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 81652 UniSTS
UniGene Rn.11199 UniSTS
UniSTS 246424 UniSTS





NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.