RH132533 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH132533

Symbol: RH132533
Previously known as: AI555274; 
RGD ID: 5047796
Expected Size: 187 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21258,563,376 - 258,563,563 (+)MAPPERmRatBN7.2
Rnor_6.01280,572,332 - 280,572,518NCBIRnor6.0
Rnor_5.01287,932,618 - 287,932,804UniSTSRnor5.0
RGSC_v3.41265,940,416 - 265,940,602UniSTSRGSC3.4
Celera1254,215,609 - 254,215,795UniSTS
RH 3.4 Map11704.4UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAAGCCCTCAGGTTGCTTTATT
Reverse Primer AGTCAGAAACCGAATGGTGGTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41352325LOC120100068uncharacterized LOC1201000681258558565258613522Rat

Nucleotide Sequences
GenBank Nucleotide CH473986 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat
631690Scl5Serum cholesterol level QTL 52.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1236125214260522016Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
1600392Bw123Body weight QTL 1230.001body mass (VT:0001259)body weight (CMO:0000012)1223201027260522016Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
631837Niddm35Non-insulin dependent diabetes mellitus QTL 350.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1238699859259647894Rat
631836Stl31Serum triglyceride level QTL 314.645e-06blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)1237147813260522016Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1300108Rf8Renal function QTL 83.75renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1228581588259647894Rat
734767Niddm57Non-insulin dependent diabetes mellitus QTL 57body mass (VT:0001259)body weight (CMO:0000012)1224054293260122809Rat
631215Stl8Serum triglyceride level QTL 89.270.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1225126575260522016Rat
7387289Uae45Urinary albumin excretion QTL 452.860.0021urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1223262787260522016Rat
631843Bw116Body weight QTL 1164.10.016abdominal adipose amount (VT:1000220)abdominal fat pad weight (CMO:0000088)1224054293260122809Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
1581544Rf52Renal function QTL 520.05urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)1232156370259647894Rat
631536Lnnr2Liver neoplastic nodule remodeling QTL 22.90.0005liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)1233948574260522016Rat
734769Niddm58Non-insulin dependent diabetes mellitus QTL 58body mass (VT:0001259)body weight (CMO:0000012)1224569538260122809Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
631669Iddm9Insulin dependent diabetes mellitus QTL 92.80.039blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1233190394258625266Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat


Additional Information